Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU070601

Sigma-Aldrich

MISSION® esiRNA

targeting human EDNRB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGTGTCCTGCCTTGTGTTCGTGCTGGGGATCATCGGGAACTCCACACTTCTGAGAATTATCTACAAGAACAAGTGCATGCGAAACGGTCCCAATATCTTGATCGCCAGCTTGGCTCTGGGAGACCTGCTGCACATCGTCATTGACATCCCTATCAATGTCTACAAGCTGCTGGCAGAGGACTGGCCATTTGGAGCTGAGATGTGTAAGCTGGTGCCTTTCATACAGAAAGCCTCTGTGGGAATCACTGTGCTGAGTCTATGTGCTCTGAGTATTGACAGATATCGAGCTGTTGCTTCTTGGAGTAGAATTAAAGGAATTGGGGTTCCAAAATGGACAGCAGTAGAAATTGTTTTGATTTGGGTGGTCTCTGTGGTTCTGGCTGTCCCTGAAGCCATAGGTTTTGATATAATTACGATGGACTACAAAGGAAGTTATCTGCGAATCTGCTTGCTT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Meena Halaka et al.
Journal of Cancer, 11(9), 2688-2701 (2020-03-24)
The endothelins and their receptors are best known for their regulation of the vascular system. Their widespread expression in epithelial cells and their overexpression in some tumors has prompted investigation into their ability to regulate cancer progression. In this study
Xi Gu et al.
Annals of the New York Academy of Sciences, 1448(1), 5-18 (2019-03-23)
Endothelin receptor B (EDNRB) is one of the receptors in the endothelin axis and its upregulated expression is associated with tumorigenesis and metastasis of several types of solid tumors. However, the expression profile of EDNRB in breast cancer and its

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique