Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU067331

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIM28

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACAAGGACCACCAGTACCAGTTCTTAGAGGATGCAGTGAGGAACCAGCGCAAGCTCCTGGCCTCACTGGTGAAGCGCCTTGGGGACAAACATGCAACATTGCAGAAGAGCACCAAGGAGGTTCGCAGCTCAATCCGCCAGGTGTCTGACGTACAGAAGCGTGTGCAAGTGGATGTCAAGATGGCCATCCTGCAGATCATGAAGGAGCTGAATAAGCGGGGCCGTGTGCTGGTCAATGATGCCCAGAAGGTGACTGAGGGGCAGCAGGAGCGCCTGGAGCGGCAGCACTGGACCATGACCAAGATCCAGAAGCACCAGGAGCACATTCTGCGCTTTGCCTCTTGGGCTCTGGAGAGTGACAACAACACAGCCCTTTTGCTTTCTAAGAAGTTGATCTACTTCCAGCTGCACCG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hitoshi Ohtani et al.
Genome research, 28(8), 1147-1157 (2018-07-05)
We provide a comprehensive genomic and epigenomic map of the more than 500,000 endogenous retroviruses (ERVs) and fragments that populate the intergenic regions of the human genome. The repressive epigenetic marks associated with the ERVs, particularly long terminal repeats (LTRs)
Min Li et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(38), 23588-23596 (2020-09-10)
In human cells, the DNA replication factor proliferating cell nuclear antigen (PCNA) can be conjugated to either the small ubiquitinlike modifier SUMO1 or SUMO2, but only SUMO2-conjugated PCNA is induced by transcription to facilitate resolution of transcription-replication conflict (TRC). To
Hongtao Liu et al.
Chemico-biological interactions, 311, 108772-108772 (2019-07-28)
Atherosclerosis is a common type of cardiovascular disease (CVD), remaining one of the leading causes of global death. Tripartite motif-containing 28 (TRIM28) is a member of TRIM family that has been found to be involved in atherosclerosis. However, the role
Xiao-Hua Zhang et al.
Molecular medicine reports, 23(3) (2021-01-06)
Myocardial ischemia/reperfusion (MIR) injury, which occurs following acute myocardial infarction, can cause secondary damage to the heart. Tripartite interaction motif (TRIM) proteins, a class of E3 ubiquitin ligases, have been recognized as critical regulators in MIR injury. Zenglv Fumai Granule (ZFG) is a
Eun Kyoung Do et al.
Cell death and differentiation, 28(2), 685-699 (2020-09-09)
Oct4 plays a crucial role in the regulation of self-renewal of embryonic stem cells (ESCs) and reprogramming of somatic cells to induced pluripotent stem cells. However, the molecular mechanisms underlying posttranslational regulation and protein stability of Oct4 remain unclear. Using

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique