Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU065891

Sigma-Aldrich

MISSION® esiRNA

targeting human MKI67

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCCAACAAGCACAAAGCAATGGCCTAAGAGAAGTCTCAGGAAAGCAGATGTAGAGGAAGAATTCTTAGCACTCAGGAAACTAACACCATCAGCAGGGAAAGCCATGCTTACGCCCAAACCAGCAGGAGGTGATGAGAAAGACATTAAAGCATTTATGGGAACTCCAGTGCAGAAACTGGACCTGGCAGGAACTTTACCTGGCAGCAAAAGACAGCTACAGACTCCTAAGGAAAAGGCCCAGGCTCTAGAAGACCTGGCTGGCTTTAAAGAGCTCTTCCAGACTCCTGGTCACACCGAGGAATTAGTGGCTGCTGGTAAAACCACTAAAATACCCTGCGACTCTCCACAGTCAGACCCAGTGGACACCCCAACAAGCACAAAGCAACGACCCAAGAGAAGTATCAGGAAAGCAGATGTAGAGGGAGAACTCTTAGCGTGCAGGAATCTAATGCCATCAGCAGGC

Numéro d'accès Ensembl | humain

ENSG00000148773

Numéro d'accès NCBI

NM_002417

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MKI67(4288) , MKI67(4288)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yusuke Horiuchi et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 19(1), 160-165 (2014-12-11)
The differences in the growth morphology, proliferative ability, and background mucosa of the cancer between Helicobacter pylori (HP)-positive (HP+) gastric cancer (GC) and HP-negative (HP-) GC are still unclear. To clarify the differences, we compared the characteristics of the two
Quim Castellví et al.
Bioelectrochemistry (Amsterdam, Netherlands), 105, 16-24 (2015-05-09)
Delivery of the so-called Tumor Treatment Fields (TTFields) has been proposed as a cancer therapy. These are low magnitude alternating electric fields at frequencies from 100 to 300 kHz which are applied continuously in a non-invasive manner. Electric field delivery
Richard A Byrd et al.
Endocrinology, 156(7), 2417-2428 (2015-04-11)
The tumorigenic potential of dulaglutide was evaluated in rats and transgenic mice. Rats were injected sc twice weekly for 93 weeks with dulaglutide 0, 0.05, 0.5, 1.5, or 5 mg/kg corresponding to 0, 0.5, 7, 20, and 58 times, respectively
Jianhui Ma et al.
Cancer cell, 35(3), 504-518 (2019-03-05)
Ionizing radiation (IR) and chemotherapy are standard-of-care treatments for glioblastoma (GBM) patients and both result in DNA damage, however, the clinical efficacy is limited due to therapeutic resistance. We identified a mechanism of such resistance mediated by phosphorylation of PTEN
Jian-Hong Fang et al.
Hepatology (Baltimore, Md.), 62(2), 452-465 (2015-02-26)
Early metastasis is responsible for frequent relapse and high mortality of hepatocellular carcinoma (HCC), but its underlying mechanisms remain unclear. Epithelial-mesenchymal transition (EMT) has been considered a key event in metastasis. Based on histological examination of serial HCC sections and
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique