Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU065291

Sigma-Aldrich

MISSION® esiRNA

targeting human NFAT5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCCTATTGCCGATGCTCAGAACCTTTCCCAGGAAACTCAAGGTTCTCTCTTTCATAGTCCAAATCCTATTGTCCACAGTCAGACTTCTACAACCTCCTCTGAACAAATGCAGCCTCCAATGTTTCACTCTCAAAGTACCATTGCTGTGTTACAGGGCTCTTCAGTTCCTCAAGACCAGCAGTCAACCAACATATTTCTTTCCCAGAGTCCCATGAATAATCTTCAGACTAACACAGTAGCCCAAGAAGCATTTTTTGCAGCACCGAACTCAATTTCTCCACTTCAGTCAACATCAAACAGTGAACAACAAGCTGCTTTCCAACAGCAAGCTCCAATATCACACATCCAGACTCCTATGCTTTCCCAAGAACAGGCACAACCCCCGCAGCAGGGTTTATTTCAGCCTCAGGTGGCCCTGGGCTCCCTTCCACCTAATCCAATGCCTCAAAGCCAACAAGGAACCAT

Numéro d'accès Ensembl | humain

ENSG00000102908

Numéro d'accès NCBI

NM_006599

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NFAT5(10725) , NFAT5(10725)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
YJU
PET
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sandrine Herbelet et al.
International journal of molecular sciences, 21(23) (2020-12-09)
Glucocorticoids are drugs of choice in Duchenne muscular dystrophy (DMD), prolonging patients' ambulation. Their mode of action at the protein level is not completely understood. In DMD, muscle tissue is replaced by fibrotic tissue produced by fibroblasts, reducing mobility. Nuclear
Saseong Lee et al.
Journal of immunology (Baltimore, Md. : 1950), 201(2), 359-370 (2018-05-26)
Fibroblast-like synoviocytes (FLSs) play a key role in the progression of rheumatoid arthritis (RA) as a primary component of invasive hypertrophied pannus. FLSs of RA patients (RA-FLSs) exhibit cancer-like features, including promigratory and proinvasive activities that largely contribute to joint
Sandrine Herbelet et al.
International journal of molecular sciences, 21(21) (2020-10-30)
Duchenne muscular dystrophy (DMD) is characterized by chronic inflammation and fibrotic tissue production by fibroblasts. The promyogenic factor nuclear factor of activated T-cells 5 (NFAT5) is virtually present in all cells, responding to hyperosmolar or pro-inflammatory stress. In embryogenic fibroblasts
Fabian Doktor et al.
Purinergic signalling, 14(4), 471-484 (2018-11-12)
Retinal hypoxia is a major condition of the chronic inflammatory disease age-related macular degeneration. Extracellular ATP is a danger signal which is known to activate the NLRP3 inflammasome in various cell systems. We investigated in cultured human retinal pigment epithelial
Margrit Hollborn et al.
Molecular vision, 21, 360-377 (2015-04-17)
High intake of dietary salt increases extracellular osmolarity, which results in hypertension, a risk factor of neovascular age-related macular degeneration. Neovascular retinal diseases are associated with edema. Various factors and channels, including vascular endothelial growth factor (VEGF) and aquaporins (AQPs)
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique