Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU064451

Sigma-Aldrich

MISSION® esiRNA

targeting human MTMR14

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTGACACGCATCTTTTTGATAAGGTCAGAGGCTATGACATCAAGCTGCTTCGATACCTGTCAGTCAAATACATCTGTGACCTGATGGTGGAGAACAAGAAGGTGAAGTTTGGCATGAATGTAACCTCCTCTGAGAAGGTGGACAAAGCCCAGCGCTATGCCGACTTCACTCTCCTCTCCATCCCGTATCCAGGCTGTGAATTTTTCAAGGAATATAAAGATCGGGATTACATGGCAGAAGGGCTCATATTTAACTGGAAGCAGGACTACGTTGATGCCCCATTGAGCATCCCCGACTTCCTGACTCACTCTCTGAACATTGACTGGAGCCAGTATCAGTGTTGGGATCTGGTGCAACAAACACAAAACTACCTGAAGCTGCTGCTTTCCTTAGTTAACAGTGATGATGACAGCGG

Numéro d'accès Ensembl | humain

ENSG00000163719

Numéro d'accès NCBI

NM_022485

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MTMR14(64419) , MTMR14(64419)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhaodong Li et al.
Gene, 691, 106-113 (2018-12-27)
Myotubularin-related protein 14 (MTMR14) is a member of the myotubularin (MTM)-related protein family and plays a key role in cardiomyopathy and autophagy. However, its potential implication in human cancer is unclear. In this study, we have investigated the expression profile
Qichen Pan et al.
Biochemical and biophysical research communications, 529(4), 1045-1052 (2020-08-21)
The phosphoinositide phosphatase, myotubularinrelated protein 14 (MTMR14), plays a critical role in the regulating autophagy. However, its functional contribution to neuronal autophagy is still unclear. In the present study, we attempted to explore the effects of MTMR14 on ischemic stroke
Jie-Lei Zhang et al.
Cell death & disease, 11(2), 140-140 (2020-02-23)
Cardiac hypertrophy (CH) is an independent risk factor for many cardiovascular diseases, and is one of the primary causes of morbidity and mortality in elderly people. Pathological CH involves excessive protein synthesis, increased cardiomyocyte size, and ultimately the development of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique