Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU052551

Sigma-Aldrich

MISSION® esiRNA

targeting human THBS2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGGCTGGGTCTATTTGTCTTCTCTCAAGAAATGGTCTATTTCTCAGACCTCAAGTACGAATGCAGAGATATTTAAACAAGATTTGCTGCATTTCCGGCAATGCCCTGTGCATGCCATGGTCCCTAGACACCTCAGTTCATTGTGGTCCTTGTGGCTTCTCTCTCTAGCAGCACCTCCTGTCCCTTGACCTTAACTCTGATGGTTCTTCACCTCCTGCCAGCAACCCCAAACCCAAGTGCCTTCAGAGGATAAATATCAATGGAACTCAGAGATGAACATCTAACCCACTAGAGGAAACCAGTTTGGTGATATATGAGACTTTATGTGGAGTGAAAATTGGGCATGCCATTACATTGCTTTTTCTTGTTTGTTTAAAAAGAATGACGTTTACATATAAAATGTAATTACTTATTGTATTTATGTGTATATGGAGTTGAAGGGAATACTGTGC

Numéro d'accès Ensembl | humain

ENSG00000186340

Numéro d'accès NCBI

NM_003247

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... THBS2(7058) , THBS2(7058)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
DOR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Q-H Liu et al.
European review for medical and pharmacological sciences, 22(19), 6230-6238 (2018-10-20)
Thrombospondin 2 (THBS2) expression and its prognostic value have been documented in several types of cancer. Nevertheless, the potential role and clinical significance of THBS2 in uveal melanoma (UM) have never been reported. Thus, in our study, we aimed to
Kyungha Shin et al.
World journal of stem cells, 11(12), 1115-1129 (2019-12-27)
Osteoarthritis (OA), a chronic age-related disease characterized by the slowly progressive destruction of articular cartilage, is one of the leading causes of disability. As a new strategy for treatment of OA, mesenchymal stem cells (MSCs) have the potential for articular
Yingqin Ye et al.
Placenta, 103, 156-163 (2020-11-01)
Circ-AK2 has been found to be differentially expressed in PE placenta tissues, however, the role and the underlying molecular mechanisms of circ-AK2 in PE remain poorly known. The expression of circ-AK2, miR-454-3p, and THBS2 mRNA was detected using quantitative real-time

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique