Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU048861

Sigma-Aldrich

MISSION® esiRNA

targeting human PALB2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCTGCCAAGCAGAAGAAAGAAGCAGCAGAAGAGGACATTTATTTCACAGGAGAGAGACTGTGTCTTTGGCACTGATTCACTCAGATTGTCTGGGAAAAGACTAAAGGAACAGGAAGAAATCAGTAGCAAAAATCCTGCTAGATCACCAGTAACTGAAATAAGAACTCACCTTTTAAGTCTTAAATCTGAACTTCCAGATTCTCCAGAACCAGTTACAGAAATTAATGAAGACAGTGTATTAATTCCACCAACTGCCCAACCAGAAAAAGGTGTTGATACATTCCTAAGAAGACCTAATTTCACCAGGGCGACTACAGTTCCTTTACAGACTCTATCAGATAGCGGTAGTAGTCAGCACCTTGAACACATTCCTCCTAAAGGTAGCAGTGAACTTACTACTCACGACCTAAAAAACATTAGATTTACTTCACCTGTAAGTTTGGAGGCACAAGGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ouyang Ge et al.
Oncology letters, 21(3), 224-224 (2021-02-23)
During DNA repair, BRCA1 and BRCA2 interact with the tumor suppressor partner and localizer of BRCA2 (PALB2). PALB2 mutations are associated with an increased risk of breast and ovarian carcinoma, and upregulated PALB2 expression is associated with poor clinical outcomes.
Antonis C Antoniou et al.
The New England journal of medicine, 371(6), 497-506 (2014-08-08)
Germline loss-of-function mutations in PALB2 are known to confer a predisposition to breast cancer. However, the lifetime risk of breast cancer that is conferred by such mutations remains unknown. We analyzed the risk of breast cancer among 362 members of
Joris Pauty et al.
Nucleic acids research, 45(5), 2644-2657 (2017-02-06)
One typical mechanism to promote genomic instability, a hallmark of cancer, is to inactivate tumor suppressors, such as PALB2. It has recently been reported that mutations in PALB2 increase the risk of breast cancer by 8-9-fold by age 40 and
Anar K Murphy et al.
The Journal of cell biology, 206(4), 493-507 (2014-08-13)
Phosphorylation of replication protein A (RPA) by Cdk2 and the checkpoint kinase ATR (ATM and Rad3 related) during replication fork stalling stabilizes the replisome, but how these modifications safeguard the fork is not understood. To address this question, we used

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique