Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU036561

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF20

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAAATGGCTGATGAGGATGCCTTGAGGAAGATCCGGGCAGTGGAGGAGCAGATAGAATACCTACAGAAGAAGCTAGCCATGGCCAAGCAGGAAGAAGAAGCACTCCTCTCTGAAATGGATGTCACAGGCCAGGCCTTTGAAGACATGCAGGAGCAAAATATCCGTTTGATGCAGCAATTGCGGGAGAAGGATGATGCAAATTTCAAGCTCATGTCAGAGCGTATCAAGTCCAATCAGATCCATAAGTTGCTTAAAGAAGAGAAGGAGGAGCTGGCAGACCAGGTGTTGACTCTGAAGACTCAGGTTGATGCCCAGCTACAGGTAGTAAGGAAACTGGAAGAGAAGGAGCATCTGTTACAGAGCAACATTGGCACAGGGGAGAAAGAGCTGGGTCTTAGGACCCAAGCCTTAGAGATGAATAAACGCAAGGCAATGGAGGCAGCCCAGCTTGCAGATGACCTCAAAGCACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jagmohan Hooda et al.
Cancer research, 79(4), 760-772 (2018-12-20)
Recent insights supporting the fallopian tube epithelium (FTE) and serous tubal intraepithelial carcinomas (STIC) as the tissue of origin and the precursor lesion, respectively, for the majority of high-grade serous ovarian carcinomas (HGSOC) provide the necessary context to study the
Danping Wang et al.
Frontiers in oncology, 10, 613470-613470 (2020-12-29)
E-cadherin, a hallmark of epithelial-mesenchymal transition (EMT), is often repressed due to Snail-mediated epigenetic modification; however, the exact mechanism remains unclear. There is an urgent need to understand the determinants of tumor aggressiveness and identify potential therapeutic targets in breast
Z-X Wang et al.
European review for medical and pharmacological sciences, 24(19), 9981-9989 (2020-10-23)
To explore the clinical significance of circRNF20 in non-small-cell lung carcinoma (NSCLC), and its regulatory effects on NSCLC cell functions by activating MAPK9. Relative levels of circRNF20 and MAPK9 in NSCLC tissues were detected by quantitative Real Time-Polymerase Chain Reaction

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique