Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU021911

Sigma-Aldrich

MISSION® esiRNA

targeting human UCHL1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGTGGCACAATCGGACTTATTCACGCAGTGGCCAATAATCAAGACAAACTGGGATTTGAGGATGGATCAGTTCTGAAACAGTTTCTTTCTGAAACAGAGAAAATGTCCCCTGAAGACAGAGCAAAATGCTTTGAAAAGAATGAGGCCATACAGGCAGCCCATGATGCCGTGGCACAGGAAGGCCAATGTCGGGTAGATGACAAGGTGAATTTCCATTTTATTCTGTTTAACAACGTGGATGGCCACCTCTATGAACTTGATGGACGAATGCCTTTTCCGGTGAACCATGGCGCCAGTTCAGAGGACACCCTGCTGAAGGACGCTGCCAAGGTCTGCAGAGAATTCACCGAGCGTGAGCAAGGAGAAGTCCGCTTCTCTGCCGTGGCTCTCTGCAAGGCAGCCTAATGCTCTGTGGGAGGGAC

Numéro d'accès Ensembl | humain

ENSG00000154277

Numéro d'accès NCBI

NM_004181

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... UCHL1(7345) , UCHL1(7345)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yanhong Luo et al.
Journal of cellular biochemistry, 119(1), 691-700 (2017-06-22)
As a de-ubiquitin enzyme, ubiquitin C-terminal hydrolase (UCH)-L1 has been shown to be overexpressed in several human cancers. However, the function of UCH-L1 in invasion of breast cancers is still unclear. Here we report that the expression of UCH-L1 is
Yuyin Xu et al.
Experimental cell research, 382(2), 111463-111463 (2019-06-28)
Diabetic nephrology (DN) is attributed largely to the depletion of podocytes, which is closely associated to apoptosis. However, the complex mechanism of podocyte loss in DN pathogenesis remains unclear. Recently, necroptosis has emerged as an important cell death model in
Wenjuan Wang et al.
Molecular carcinogenesis, 55(9), 1329-1342 (2015-08-22)
Multidrug resistant (MDR) cancer cells overexpressing P-glycoprotein (P-gp) exhibit enhanced invasive/metastatic ability as compared with the sensitive cells. We aimed to clarify the mechanism underlying this observation and found that during the development of drug resistance to adriamycin in MCF7
Hongbo Gao et al.
Biochemical and biophysical research communications, 492(1), 96-102 (2017-08-15)
Skeletal muscles are dynamic tissues that possess regenerative abilities, which require multiple processes and regulatory factors. Ubiquitin C-Terminal Hydrolase L1 (UCHL1), which is primarily expressed in neuronal tissues, was upregulated in skeletal muscles in disease conditions but its functional role
Eun Young Seo et al.
The Journal of investigative dermatology, 137(8), 1757-1765 (2017-04-11)
Ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) is involved in many signaling pathways via the ubiquitin-proteasome system. UCHL1 is expressed in the human skin and serves as a neuronal marker; however, its functions in melanogenesis remain unknown. Here, we investigated the role
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique