Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU016801

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFB1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCCTGAGGCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATCTATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGATACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTCACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGCGCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Satomi Furukawa et al.
Experimental cell research, 383(1), 111506-111506 (2019-07-22)
NOD-like receptor family, pyrin domain-containing 3 (NLRP3) is one of the key components of the inflammasome. NLRP3 also participates in the regulation of fibrosis independent of the inflammasome. In this study, we analyzed the mechanism of upregulation of NLRP3 expression
Danae E Zamboulis et al.
eLife, 9 (2020-10-17)
Mature connective tissues demonstrate highly specialised properties, remarkably adapted to meet their functional requirements. Tissue adaptation to environmental cues can occur throughout life and poor adaptation commonly results in injury. However, the temporal nature and drivers of functional adaptation remain
Hendrik Ungefroren et al.
Cancers, 12(12) (2020-12-03)
Autocrine transforming growth factor (TGF)β has been implicated in epithelial-mesenchymal transition (EMT) and invasion of several cancers including pancreatic ductal adenocarcinoma (PDAC) as well as triple-negative breast cancer (TNBC). However, the precise mechanism and the upstream inducers or downstream effectors

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique