Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU014641

Sigma-Aldrich

MISSION® esiRNA

targeting human ANKRD1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACTTCTAGCCCACCCTGTGACCCTGGGGGAGCAACAGTGGAAAAGCGAGAAACAACGAGAGGCAGAGCTCAAAAAGAAAAAACTAGAACAAAGATCAAAGCTTGAAAATTTAGAAGACCTTGAAATAATCATTCAACTGAAGAAAAGGAAAAAATACAGGAAAACTAAAGTTCCAGTTGTAAAGGAACCAGAACCTGAAATCATTACGGAACCTGTGGATGTGCCTACGTTTCTGAAGGCTGCTCTGGAGAATAAACTGCCAGTAGTAGAAAAATTCTTGTCAGACAAGAACAATCCAGATGTTTGTGATGAGTATAAACGGACAGCTCTTCATAGAGCATGCTTGGAAGGACATTTGGCAATTGTGGAGAAGTTAATGGAAGCTGGAGCCCAGATCGAATTCCGTGATATGCTTGAATCCACAGCCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Adriana P Jiménez et al.
Oncotarget, 8(51), 88437-88452 (2017-11-29)
The Hippo pathway regulates organ size, growth and comprises several tumor related factors, including the oncoprotein YAP1 and the tumor suppressor RASSF1A.
Akiko Takahashi et al.
Scientific reports, 8(1), 14896-14896 (2018-10-07)
Overcoming acquired resistance to epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) is critical in combating EGFR-mutant non-small cell lung cancer (NSCLC). We tried to construct a novel therapeutic strategy to conquer the resistance to second-and third-generation EGFR-TKIs in EGFR-positive
Fang Lu et al.
PloS one, 9(5), e97743-e97743 (2014-05-30)
The caspase-associated recruitment domain-containing protein (CARP) is expressed in almost all tissues. Recently, the tumor-suppressive function of CARP was discovered and attracted increasing attention. This study aimed to investigate the role of CARP in the carcinogenesis of human gastric carcinoma.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique