Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU009931

Sigma-Aldrich

MISSION® esiRNA

targeting human BAMBI

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
249.00 CHF
50 μG
443.00 CHF

249.00 CHF

Check Cart for Availability
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
249.00 CHF
50 μG
443.00 CHF

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

249.00 CHF

Check Cart for Availability

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAAAGGTGAAATTCGATGCTACTGTGATGCTGCCCACTGTGTAGCCACTGGTTATATGTGTAAATCTGAGCTCAGCGCCTGCTTCTCTAGACTTCTTGATCCTCAGAACTCAAATTCCCCACTCACCCATGGCTGCCTGGACTCTCTTGCAAGCACGACAGACATCTGCCAAGCCAAACAGGCCCGAAACCACTCTGGCACCACCATACCCACATTGGAATGCTGTCATGAAGACATGTGCAATTACAGAGGGCTGCACGATGTTCTCTCTCCTCCCAGGGGTGAGGCCTCAGGACAAGGAAACAGGTATCAGCATGATGGTAGCAGAAACCTTATCACCAAGGTGCAGGAGCTGACTTCTTCCAAAGAGTTGTGGTTCCGGGCAGCGGTCATTGCCGTGCCCATTGCTGGAGGGCTGATTTTAGTGTTGCTTATTATGTTGGCCCTGAGGATGCTTCGAAGTGAAAATAAGAGGCTGCAGGATCAGCGGCAACAGATGCTCTCCCGTTTGCACTACAGCTTTCACGG

Numéro d'accès Ensembl | humain

ENSG00000095739

Numéro d'accès NCBI

NM_012342

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... BAMBI(25805) , BAMBI(25805)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
OAV
NZU
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhao Wang et al.
OncoTargets and therapy, 13, 131-142 (2020-02-06)
Non-small cell lung cancer (NSCLC) is a common malignancy over the world. Previous report indicated that the plasmacytoma variant translocation 1 (PVT1) has been documented to function as an oncogene in various types of human cancers. However, the biological mechanism
Longbiao Yang et al.
Molecular medicine reports, 20(4), 3901-3909 (2019-09-06)
To investigate the role of microRNA (miR)‑519d‑3p in postoperative epidural scar formation and its regulation of the bone morphogenetic protein and activin membrane‑bound inhibitor (BAMBI), miR‑519d‑3p and BAMBI expression levels in the lumbar disc of patients who had undergone laminectomy
Jingjing He et al.
Growth factors (Chur, Switzerland), 34(5-6), 210-216 (2017-02-18)
Fibroblast growth factor-1 (FGF-1) promotes differentiation of human preadipocytes into mature adipocytes via modulation of a BMP and Activin Membrane-Bound Inhibitor (BAMBI)/Peroxisome proliferator-activated receptor (PPARγ)-dependent network. Here, we combined transcriptomic and functional investigations to identify novel downstream effectors aligned with
Long Bai et al.
Cellular signalling, 37, 52-61 (2017-06-05)
Bone morphogenetic protein and activin membrane-bound inhibitor (BAMBI) is a transforming growth factor β (TGF-β) type I receptor antagonist that negatively regulates TGF-β and bone morphogenetic protein (BMP) signaling. BAMBI has been shown to be regulated by TGF-β signaling; however
Christopher Grunseich et al.
Molecular cell, 69(3), 426-437 (2018-02-06)
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique