Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU008731

Sigma-Aldrich

MISSION® esiRNA

targeting human NR4A2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCAGTGGAGGGTAAACTCATCTTTTGCAATGGGGTGGTCTTGCACAGGTTGCAATGCGTTCGTGGCTTTGGGGAATGGATTGATTCCATTGTTGAATTCTCCTCCAACTTGCAGAATATGAACATCGACATTTCTGCCTTCTCCTGCATTGCTGCCCTGGCTATGGTCACAGAGAGACACGGGCTCAAGGAACCCAAGAGAGTGGAAGAACTGCAAAACAAGATTGTAAATTGTCTCAAAGACCACGTGACTTTCAACAATGGGGGGTTGAACCGCCCCAATTATTTGTCCAAACTGTTGGGGAAGCTCCCAGAACTTCGTACCCTTTGCACACAGGGGCTACAGCGCATTTTCTACCTGAAATTGGAAGACTTGGTGCCACCGCCAGCAATAATTGACAAACTTTTCCTGGACACTTTACCTTTCTAAGACCTCCTCCCAAGCACTTCAAAGGAACTGGAATGATAATGGAAACTGTCAAGAGGGGGCAAGTCACATGGGCAGAGATAGCCGTGTGAGCAGTCTCAGCTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Soo Min Kim et al.
Molecules and cells, 43(6), 551-571 (2020-06-12)
Nuclear receptor-related 1 (Nurr1) protein has been identified as an obligatory transcription factor in midbrain dopaminergic neurogenesis, but the global set of human NURR1 target genes remains unexplored. Here, we identified direct gene targets of NURR1 by analyzing genome-wide differential
Shawn Llopis et al.
BMC cancer, 13, 139-139 (2013-03-23)
NR4A orphan nuclear receptors are involved in multiple biological processes which are important in tumorigenesis such as cell proliferation, apoptosis, differentiation, and glucose utilization. The significance of NR4A family member NURR1 (NR4A2) in breast cancer etiology has not been elucidated.
Xin Heng et al.
Molecular neurodegeneration, 7, 4-4 (2012-02-03)
NURR1 (also named as NR4A2) is a member of the steroid/thyroid hormone receptor family, which can bind to DNA and modulate expression of target genes. Previous studies have shown that NURR1 is essential for the nigral dopaminergic neuron phenotype and
Hiroki Shimada et al.
FEBS open bio, 7(9), 1410-1421 (2017-09-15)
Aldosterone synthase is the key rate-limiting enzyme in adrenal aldosterone production, and induction of its gene (
S Loppi et al.
Brain, behavior, and immunity, 73, 670-681 (2018-08-01)
Ischemic stroke is amongst the leading causes of death and disabilities. The available treatments are suitable for only a fraction of patients and thus novel therapies are urgently needed. Blockage of one of the cerebral arteries leads to massive and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique