Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU004651

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPU

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCAGAGCCAAATCTCCTCAGCCACCTGTTGAAGAAGAAGATGAACACTTCGATGACACAGTGGTTTGTCTTGATACTTATAATTGTGATCTACATTTTAAAATATCAAGAGATCGTCTCAGTGCTTCTTCCCTTACAATGGAGAGTTTTGCTTTTCTTTGGGCTGGAGGAAGAGCATCCTATGGTGTGTCAAAAGGCAAAGTGTGTTTTGAGATGAAGGTTACAGAGAAGATCCCAGTAAGGCATTTATATACAAAAGATATTGACATACATGAAGTTCGTATTGGCTGGTCACTAACTACAAGTGGAATGTTACTTGGTGAAGAAGAATTTTCTTATGGGTATTCTCTAAAAGGAATAAAAACATGCAACTGTGAGACTGAAGATTATGGAGAAAAGTTTGATGAAAATGATGTGATTACATGTTTTGCTAACTTTGAAAGTGATGAAGTAGAACTCTCGTATGCTAAGAATGGACAAGATCTTGGCGTTGCCTTCAAAATCAGTAAGGAAGTTCTTGCTGGACGGCCACTGTTCCCGCATGTTCTCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ezgi Hacisuleyman et al.
Nature communications, 7, 11021-11021 (2016-03-25)
More than half the human and mouse genomes are comprised of repetitive sequences, such as transposable elements (TEs), which have been implicated in many biological processes. In contrast, much less is known about other repeats, such as local repeats that
Lili Cao et al.
Cell host & microbe, 26(3), 369-384 (2019-09-13)
Pathogen pattern recognition receptors (PRRs) trigger innate immune responses to invading pathogens. All known PRRs for viral RNA have extranuclear localization. However, for many viruses, replication generates dsRNA in the nucleus. Here, we show that the nuclear matrix protein SAFA

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique