Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU004281

Sigma-Aldrich

MISSION® esiRNA

targeting human IDH2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCCCATCATCTGCAAAAACATCCCACGCCTAGTCCCTGGCTGGACCAAGCCCATCACCATTGGCAGGCACGCCCATGGCGACCAGTACAAGGCCACAGACTTTGTGGCAGACCGGGCCGGCACTTTCAAAATGGTCTTCACCCCAAAAGATGGCAGTGGTGTCAAGGAGTGGGAAGTGTACAACTTCCCCGCAGGCGGCGTGGGCATGGGCATGTACAACACCGACGAGTCCATCTCAGGTTTTGCGCACAGCTGCTTCCAGTATGCCATCCAGAAGAAATGGCCGCTGTACATGAGCACCAAGAACACCATACTGAAAGCCTACGATGGGCGTTTCAAGGACATCTTCCAGGAGATCTTTGACAAGCACTATAAGACCGACTTCGACAAGAATAAGATCTGGTATGAGCACCGGCTCATTGATGACATGGTGGCTCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bonnie H Y Yeung et al.
American journal of respiratory cell and molecular biology, 63(1), 36-45 (2020-03-10)
Global DNA hydroxymethylation mediated by the TET (ten-eleven translocation) enzyme was induced in allergen-induced airway hyperresponsiveness in mouse lung tissues and specifically in isolated airway smooth muscle (ASM) cells. TET is an α-ketoglutarate (α-KG)-dependent enzyme, and the production of α-KG
Fen Gong et al.
Biochemical and biophysical research communications, 514(3), 593-600 (2019-05-09)
Nonalcoholic fatty liver disease (NAFLD) has become an epidemic across the world. A large and growing unmet therapeutic requirement has inspired plenty exploration in the field. Isocitrate dehydrogenase 2 (IDH2), localized in mitochondria, decreases NADP+ to NADPH during the decarboxylation
Su-Jeong Choi et al.
Biochemical and biophysical research communications, 503(3), 1805-1811 (2018-08-04)
Isocitrate dehydrogenase 2 (IDH2) is an essential enzyme in the mitochondrial antioxidant system, which produces nicotinamide adenine dinucleotide phosphate, and thereby defends against oxidative stress. We have shown that IDH2 downregulation results in mitochondrial dysfunction and reactive oxygen species (ROS)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique