Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU001761

Sigma-Aldrich

MISSION® esiRNA

targeting human LRRC8A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGACATTGTGTACCGCCTCTACATGCGGCAGACCATCATCAAGGTGATCAAGTTCATCCTCATCATCTGCTACACCGTCTACTACGTGCACAACATCAAGTTCGACGTGGACTGCACCGTGGACATTGAGAGCCTGACGGGCTACCGCACCTACCGCTGTGCCCACCCCCTGGCCACACTCTTCAAGATCCTGGCGTCCTTCTACATCAGCCTAGTCATCTTCTACGGCCTCATCTGCATGTATACACTGTGGTGGATGCTACGGCGCTCCCTCAAGAAGTACTCGTTTGAGTCGATCCGTGAGGAGAGCAGCTACAGCGACATCCCCGACGTCAAGAACGACTTCGCCTTCATGCTGCACCTCATTGACCAATACGACCCGCTCTACTCCAAGCGCTTCGCCGTCTTCCTGTCGGAGGTGAGTGAGAACAAGCTGCGGCAGCTGAACCTCAACAACGAGTGGACGCTGGACAAGCTCCGGCAGCGGCTCACCAAGAACGCGCAGGACAAGCTGGAGCTGCACCTGTTCATGCTCAGTGGCATCCCTGACACTGTGTTTGACCTGGTGGAGCT

Numéro d'accès Ensembl | humain

ENSG00000136802

Numéro d'accès NCBI

NM_019594

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... LRRC8A(56262) , LRRC8A(56262)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chao Yang et al.
Human cell, 32(1), 41-50 (2018-11-15)
Chloride (Cl-), a primary anion in the extracellular fluid, plays an important role in a variety of physiological and pathological processes, such as cell apoptosis and proliferation. However, the information about Cl- in cancer cell apoptosis and chemoresistance is poorly
Atsushi Shiozaki et al.
International journal of oncology, 55(4), 905-914 (2019-08-23)
Although peritoneal lavage with distilled water performed after surgery prevents peritoneal seeding, cancer cells may avoid rupture under mild hypotonicity through regulatory volume decrease (RVD), which is the homeostatic regulation of ion and water transport. The aim of the present study
Tomoki Konishi et al.
The American journal of pathology, 189(10), 1973-1985 (2019-07-20)
The volume-regulated anion channel is composed of leucine-rich repeat-containing protein A (LRRC8A) and is activated by hypotonic conditions to implement the process of regulatory volume decrease. The role of LRRC8A in regulating genes related to progression of esophageal squamous cell
Unnur Arna Thorsteinsdottir et al.
Phytotherapy research : PTR, 30(1), 97-104 (2015-11-10)
We have tested the effect of protolichesterinic acid (PA) on the activity of the volume-sensitive release pathway for the organic osmolyte taurine (VSOAC) and the expression of the leucine-rich-repeat-channel 8A (LRRC8A) protein, which constitutes an essential VSOAC component. Exposing human
Andrea Milenkovic et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(20), E2630-E2639 (2015-05-06)
In response to cell swelling, volume-regulated anion channels (VRACs) participate in a process known as regulatory volume decrease (RVD). Only recently, first insight into the molecular identity of mammalian VRACs was obtained by the discovery of the leucine-rich repeats containing

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique