Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU055151

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hdac6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGGTACTTCCCATCGCCTATGAGTTTAACCCAGAACTGGTGCTGATCTCAGCTGGCTTTGATGCTGCACAAGGGGATCCGCTGGGGGGCTGCCAAGTAACACCGGAAGGTTATGCCCACCTCACCCACCTACTGATGGGCCTTGCTGGTGGCCGTATTATTCTTATTCTAGAGGGTGGATACAATTTGGCATCTATCTCTGAGTCTATGGCTGCCTGCACCCATTCCCTCCTTGGAGACCCACCACCCCAGCTTACTTTGCTGCGACCGCCACAGTCAGGAGCCCTGGTTTCAATCAGTGAGGTCATCCAAGTCCATCGCAAATACTGGCGCAGTTTGCGGTTGAGTAAAATGGAAGACAAGGAAGAATGCTCTAGTTCTAGGCTTGTCGTCAAGAAGTTGCCCCCAACAGCCAGTCCTGTATCAGCTAAGGAAATGACCACACCGAAAGGAAAGGTTCCTGAAGAAAGCGTGAGGAAGACCA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Smita Salian-Mehta et al.
The Journal of biological chemistry, 290(22), 14045-14056 (2015-04-16)
The impact of histone deacetylases (HDACs) in the control of gonadotropin releasing hormone (GnRH) neuronal development is unknown. We identified an increase in many HDACs in GT1-7 (differentiated) compared with NLT (undifferentiated) GnRH neuronal cell lines. Increased HDAC9 mRNA and
Regina Kanski et al.
Journal of cell science, 127(Pt 20), 4368-4380 (2014-08-17)
Glial fibrillary acidic protein (GFAP) is the main intermediate filament in astrocytes and is regulated by epigenetic mechanisms during development. We demonstrate that histone acetylation also controls GFAP expression in mature astrocytes. Inhibition of histone deacetylases (HDACs) with trichostatin A
Yixuan Li et al.
Molecular and cellular biology, 35(20), 3547-3565 (2015-08-05)
Histone deacetylase (HDAC) inhibition leads to cell cycle arrest in G1 and G2, suggesting HDACs as therapeutic targets for cancer and diseases linked to abnormal cell growth and proliferation. Many HDACs are transcriptional repressors. Some may alter cell cycle progression
María-Soledad Valera et al.
Retrovirology, 12, 53-53 (2015-06-25)
Human immunodeficiency virus type 1 (HIV-1) has evolved a complex strategy to overcome the immune barriers it encounters throughout an organism thanks to its viral infectivity factor (Vif), a key protein for HIV-1 infectivity and in vivo pathogenesis. Vif interacts

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique