Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU115751

Sigma-Aldrich

MISSION® esiRNA

targeting human PRMT1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGATTATGCGGTGAAGATCGTCAAAGCCAACAAGTTAGACCACGTGGTGACCATCATCAAGGGGAAGGTGGAGGAGGTGGAGCTCCCAGTGGAGAAGGTGGACATCATCATCAGCGAGTGGATGGGCTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTCTATGCCCGGGACAAGTGGCTGGCGCCCGATGGCCTCATCTTCCCAGACCGGGCCACGCTGTATGTGACGGCCATCGAGGACCGGCAGTACAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTCGACATGTCTTGCATCAAAGATGTGGCCATTAAGGAGCCCCTAGTGGATGTCGTGGACCCCAAACAGCTGGTCACCAACGCCTGCCTCATAAAGGAGGTGGACATCTATACCGTCAAGGTGGAAGACCTGACC

Numéro d'accès Ensembl | humain

ENSG00000126457

Numéro d'accès NCBI

NM_198319

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PRMT1(3276) , PRMT1(3276)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Eun-Kyung Moon et al.
The Korean journal of parasitology, 55(2), 109-114 (2017-05-17)
Protein arginine methyltransferase (PRMT) is an important epigenetic regulator in eukaryotic cells. During encystation, an essential process for
Jong-Hyun Nho et al.
Biochemical and biophysical research communications, 530(2), 389-395 (2020-06-14)
Recent studies have revealed that protein arginine methyltransferases (PRMTs) are responsible for diverse neurodegenerative diseases. However, their pathophysiological role in dopaminergic neuronal death in Parkinson's disease (PD) has not been evaluated. In this study, we demonstrated that 1-Methyl-4-phenylpyridinium iodide (MPP+)
Sreedevi Avasarala et al.
The Journal of biological chemistry, 290(21), 13479-13489 (2015-04-08)
Protein arginine methyl transferase 1 (PRMT1) was shown to be up-regulated in cancers and important for cancer cell proliferation. However, the role of PRMT1 in lung cancer progression and metastasis remains incompletely understood. In the present study, we show that
Weiqi Zhai et al.
Journal of immunology (Baltimore, Md. : 1950), 206(1), 11-22 (2020-11-27)
Protein arginine methyltransferase-1 (PRMT1) is an important epigenetic regulator of cell function and contributes to inflammation and remodeling in asthma in a cell type-specific manner. Disease-specific expression patterns of microRNAs (miRNA) are associated with chronic inflammatory lung diseases, including asthma.
Bingshou Li et al.
Biochemical and biophysical research communications, 464(4), 982-987 (2015-07-15)
Accumulating evidence indicates that microRNAs function as oncogenes or tumor suppressor genes in human cancer. MiR-503 is deregulated in various human cancers and has been associated with hepatocellular carcinoma (HCC) progression. However, the underlying mechanisms of miR-503 involvement in the
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique