Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU002721

Sigma-Aldrich

MISSION® esiRNA

targeting human ERN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
315,00 $
50 μG
596,00 $

315,00 $

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
315,00 $
50 μG
596,00 $

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

315,00 $

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACAGTGACGCTTCCTGAAACCTTGTTGTTTGTGTCAACGCTGGATGGAAGTTTGCATGCTGTCAGCAAGAGGACAGGCTCAATCAAATGGACTTTAAAAGAAGATCCAGTCCTGCAGGTCCCAACACATGTGGAAGAGCCTGCCTTTCTCCCAGATCCTAATGATGGCAGCCTGTATACGCTTGGAAGCAAGAATAATGAAGGCCTGACGAAACTTCCTTTTACCATCCCAGAATTGGTGCAGGCATCCCCATGCCGAAGTTCAGATGGAATCCTCTACATGGGTAAAAAGCAGGACATCTGGTATGTTATTGACCTCCTGACCGGAGAGAAGCAGCAGACTTTGTCATCGGCCTTTGCAGATAGTCTCTGCCCATCAACCTCTCTTCTGTATCTTGGGCGAACAGAATACACCATCACCATGTACGACACCAAAACCCGAGAGCTCCGGTGGAATGCCACCTACTTTGACTATGCGGCCTCACTGCCTGAGGACGACGTGGACTACAAGATGTCCCACTTTGTGTCCAATGGTGATGGGCTGGTGGTGACTGTGGACAGT

Numéro d'accès Ensembl | humain

ENSG00000178607

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ERN1(2081) , ERN1(2081)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
JUU
TAT
HRX

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Anne-Sophie Michallet et al.
PloS one, 6(10), e25820-e25820 (2011-10-27)
To determine whether the Unfolded Protein Response (UPR) sensors (PERK, ATF6 and IRE-1) can be targeted to promote death of Multiple Myeloma (MM) cells. We have knocked-down separately each UPR stress sensor in human MM cell lines using RNA interference
Xiaoli Hu et al.
Cancer cell international, 20, 250-250 (2020-06-23)
Acute myeloid leukemia (AML) patients with FMS-like tyrosine kinase 3-internal tandem duplication (FLT3-ITD) have a high relapse rate and poor prognosis. This study aims to explore the underlying mechanism of combining Gilteritinib with ATO at low concentration in the treatment
Antonello Storniolo et al.
Oxidative medicine and cellular longevity, 2015, 645157-645157 (2015-04-30)
Relative to their normal counterparts, tumor cells generally exhibit a greater "stress phenotype" and express heat shock proteins (Hsp) that represent candidate targets for anticancer therapy. Here we investigated the role of Hsp70 in survival induced by endoplasmic reticulum (ER)
Qun Lai et al.
Yonsei medical journal, 54(6), 1407-1415 (2013-10-22)
To investigate the anti-apoptotic mechanism of leptin in non-small cell lung cancer. The influences of leptin on apoptosis were investigated, analyzing the mechanism that triggers growth of A549 cells. The effects of leptin on cell proliferation were examined by XTT
Xia Sheng et al.
EMBO molecular medicine, 7(6), 788-801 (2015-04-13)
The unfolded protein response (UPR) is a homeostatic mechanism to maintain endoplasmic reticulum (ER) function. The UPR is activated by various physiological conditions as well as in disease states, such as cancer. As androgens regulate secretion and development of the
Afficher tous les articles scientifiques apparentés

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique