Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU093581

Sigma-Aldrich

MISSION® esiRNA

targeting human CTNND1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGGCTGAAGTTGAACATGGGAGCTTATTGCTAATTTAGAGATAGGAAACTGAAGCATAAAGAATTAATGACTTACTTTAATTACTGGAATTCTTCTGCAACATTTGACAAAACTAACCTTGAATAAGGCCCACTGTAATACGTAGCTCTCTTAAATATAACACTTAGGACTAGAAGATTAGAAACTACCAATCCCAACTACGTAATAGGAAAATGTAGGATCAAAAGGCCCATGTATATAAGTACTGACCACTGGGCCATAATGTTGCTTCTCAGGCTATATGCAGTCCTTTAGTCAGAAGTCAATAGGCCTATTTATTAATATTTTACAGACCATATTACCTGGATTACCAGGGACTATCTTTGCTGC

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Alisha M Mendonsa et al.
PloS one, 15(6), e0235337-e0235337 (2020-06-27)
p120-catenin is considered to be a tumor suppressor because it stabilizes E-cadherin levels at the cell surface. p120-catenin phosphorylation is increased in several types of cancer, but the role of phosphorylation in cancer is unknown. The phosphorylation state of p120-catenin
Xiao-Hui Gao et al.
Scientific reports, 10(1), 44-44 (2020-01-09)
Low miR-96-5p expression is characteristic of many cancers but its role in breast cancer (BCa) remains poorly defined. Here, the role of miR-96-5p in BC development was assessed. We demonstrate that exogenously expressing miR-96-5p inhibits the proliferative, migratory and invasive
Ningjia Cao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 106, 483-490 (2018-07-11)
MicroRNAs (miRNAs) are solid factors involved in the initiation and progression of hepatocellular carcinoma (HCC). Recently, miR-298 is recognized as a cancer-associated miRNA in breast, gastric and ovarian cancer. However, the functional role of miR-298 and its underlying mechanism are
Rong Wang et al.
Molecular carcinogenesis, 56(7), 1733-1742 (2017-02-22)
The heterocyclic amine 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) targets multiple organs for tumorigenesis in the rat, including the colon and the skin. PhIP-induced skin tumors were subjected to mutation screening, which identified genetic changes in Hras (7/40, 17.5%) and Tp53 (2/40, 5%), but
Josué Curto et al.
Molecular oncology, 12(5), 611-629 (2018-02-22)
Canonical and noncanonical Wnt pathways share some common elements but differ in the responses they evoke. Similar to Wnt ligands acting through the canonical pathway, Wnts that activate the noncanonical signaling, such as Wnt5a, promote Disheveled (Dvl) phosphorylation and its

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique