Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU027341

Sigma-Aldrich

MISSION® esiRNA

targeting human DDB1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCACCGTCACTCTCAAGGATCTCCGTGTAGAACTCCTTGGAGAGACCTCTATTGCTGAGTGCTTGACATACCTTGATAATGGTGTTGTGTTTGTCGGGTCTCGCCTGGGTGACTCCCAGCTTGTGAAGCTCAACGTTGACAGTAATGAACAAGGCTCCTATGTAGTGGCCATGGAAACCTTTACCAACTTAGGACCCATTGTCGATATGTGCGTGGTGGACCTGGAGAGGCAGGGGCAGGGGCAGCTGGTCACTTGCTCTGGGGCTTTCAAGGAAGGTTCTTTGCGGATCATCCGGAATGGAATTGGAATCCACGAGCATGCCAGCATTGACTTACCAGGCATCAAAGGATTATGGCCACTGCGGTCTGACCCTAATCGTGAGACTGATGACACTTTGGTGCTCTCTTTTGTGGGCCAGACAAGAGTTCTCATGTTAAATGGAGAGGAGGTAGAAGAAACCGAACTGATGGGTTTCGTGGATGATC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Huiming Lu et al.
Nature communications, 8(1), 2039-2039 (2017-12-13)
Pathway choice within DNA double-strand break (DSB) repair is a tightly regulated process to maintain genome integrity. RECQL4, deficient in Rothmund-Thomson Syndrome, promotes the two major DSB repair pathways, non-homologous end joining (NHEJ) and homologous recombination (HR). Here we report
Hiroaki Kawara et al.
Biochemical and biophysical research communications, 519(1), 204-210 (2019-09-09)
The ERCC1-XPF heterodimer is a structure-specific endonuclease and plays multiple roles in various DNA repair pathways including nucleotide excision repair and also telomere maintenance. The dimer formation, which is mediated by their C-terminal helix-hairpin-helix regions, is essential for their endonuclease
Qiuling Li et al.
The Journal of biological chemistry, 290(35), 21553-21567 (2015-07-15)
Pygopus 2 (Pygo2/PYGO2) is an evolutionarily conserved coactivator and chromatin effector in the Wnt/β-catenin signaling pathway that regulates cell growth and differentiation in various normal and malignant tissues. Although PYGO2 is highly overexpressed in a number of human cancers, the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique