Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU190491

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkaa1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTAAAGAAAGAAAAGTTGCAAGAATTTAGTGACTGCATGTGTATTTACTACTTAGCTCCTACAACTACTGTTTGGCCATATTTGCTCTCTAGATCCACACATGTATAATATACAGATATGCACATATATTCGAGTATATGTTTGCTTTTATTCTGAACCACTGAGATGTTAAGGTATATATATATATATATATATACCAGCCCTGAATACTTCAGCACTTCCTAAAAATAATAATAATGTCCTTTAGAAACCTTCTGAAACCATTATAAAATCAATAATTTCCAGATAGTGCCTGGTTTTCCAGATTAGCTGTAACTGCCCAGAATTCCATTTAAGTTACAGCCTGATTTTATTTGCAGTTCTTTAATCAGGTTAATAACACTATTTTGAAAAGATGTAGAAGAAATCCTTTCTTCAAACTGGCCAAGTTTATTTCAGGTTTTAATTCAAAATAATGAGTGGCTAAAGAAGTGTGATTTTTCTTCAATCTCTGATTTATATGCCTCTCTCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ichiro Kawashima et al.
Experimental hematology, 43(7), 524-533 (2015-04-08)
Adenosine monophosphate-activated protein kinase (AMPK) is a sensor for cellular energy status. When the cellular energy level is decreased, AMPK is activated and functions to suppress energy-consuming processes, including protein synthesis. Recently, AMPK has received attention as an attractive molecular
Dong Joo Shin et al.
Journal of cellular biochemistry, 115(10), 1702-1711 (2014-05-14)
Various health effects have been attributed to the ginsenoside metabolite 20-O-β-D-glucopyranosyl-20(S)-protopanaxadiol (GPD); however, its effect on ultraviolet (UV)-induced matrix metalloproteinase (MMP)-1 expression and the mechanism underlying this effect are unknown. We examined the inhibitory effect of GPD on UV-induced MMP-1
Yan Lu et al.
Journal of cardiovascular pharmacology, 64(5), 420-430 (2014-07-01)
: Endocannabinoids are bioactive amides, esters, and ethers of long-chain polyunsaturated fatty acids. Evidence suggests that activation of the endocannabinoid pathway offers cardioprotection against myocardial ischemia, arrhythmias, and endothelial dysfunction of coronary arteries. As cardiac hypertrophy is a convergence point
Julie Sesen et al.
PloS one, 10(4), e0123721-e0123721 (2015-04-14)
High-grade gliomas, glioblastomas (GB), are refractory to conventional treatment combining surgery, chemotherapy, mainly temozolomide, and radiotherapy. This highlights an urgent need to develop novel therapies and increase the efficacy of radio/chemotherapy for these very aggressive and malignant brain tumors. Recently
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service