Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU115611

Sigma-Aldrich

MISSION® esiRNA

targeting human NPM1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGGTGCAAAGGATGAGTTGCACATTGTTGAAGCAGAGGCAATGAATTACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGGTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAGCTGTGGAGGAAGATGCAGAGTCAGAAGATGAAGAGGAGGAGGATGTGAAACTCTTAAGTATATCTGGAAAGCGGTCTGCCCCTGGAGGTGGTAGCAAGGTTCCACAGAAAAAAGTAAAACTTGCTGCTGATGAAGATGATGACGATGATGATGAAGAGGATGATGATGAAGATGATGATGATGATGATTTTGATGATGAGGAAGCTGAAGAAAAAGCGCCAGTGAAGAAA

Ensembl | human accession no.

ENSG00000181163

NCBI accession no.

NM_199185

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NPM1(4869) , NPM1(4869)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dan Li et al.
The American journal of Chinese medicine, 45(3), 599-614 (2017-04-08)
Abundant evidence supports the key role of ultraviolet radiation (UVR) in skin cancer development. The human skin, especially the epidermal layer, is the main defense against UV radiation. Baicalin is a major bioactive component of Scutellaria baicalensis Georgi, a plant
L Lam et al.
Oncogenesis, 1, e4-e4 (2012-01-01)
Nucleophosmin (NPM) is a nucleolar phosphoprotein that is involved in many cellular processes and has both oncogenic and growth suppressing activities. NPM is localized primarily in nucleoli but shuttles between the nucleus and the cytoplasm, and sustained cytoplasmic distribution contributes
Derek Hang-Cheong Cheung et al.
Scientific reports, 7, 43650-43650 (2017-03-04)
Telomerase activation and telomere maintenance are critical for cellular immortalization and transformation. PIN2/TERF1-interacting telomerase inhibitor 1 (PinX1) is a telomerase regulator and the aberrant expression of PinX1 causes telomere shortening. Identifying PinX1-interacting proteins is important for understanding telomere maintenance. We
Qing-Qing Wang et al.
Chinese journal of cancer, 30(12), 853-860 (2011-11-22)
Nucleophosmin/B23 (NPM) is a universally expressed nucleolar phosphoprotein that participates in proliferation, apoptosis, ribosome assembly, and centrosome duplication; however, the role of NPM in cell cycle regulation is not well characterized. We investigated the mechanism by which NPM is involved
Laura Arnoldo et al.
Scientific reports, 5, 8552-8552 (2015-02-26)
High Mobility Group A are non-histone nuclear proteins that regulate chromatin plasticity and accessibility, playing an important role both in physiology and pathology. Their activity is controlled by transcriptional, post-transcriptional, and post-translational mechanisms. In this study we provide evidence for
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service