Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU056071

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mavs

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TAGGAAGCCCTGAGCCACTAGCCACCCAGCAGCCCCAAGAAGAGGAAGAACATTGTGCCAGTTCAATGCCCTGGGCTAAGTGGCTTGGGGCCACCAGTGCACTCTTGGCTGTATTCCTGGCAGTGATGCTGTACCGTAGTAGGCGCCTGGCCCAGTGAAGCCTCAGCTGTATGCTGTTCTCTTGCTCAGTTCTGCCAAGCATGTTCTCTAGGCTTGGGCTAGTAGAGGCTGAGTCAGAGAAACTTAAATATGGCGAGGTCCACTGAGCTATCCAGGTAGATAGCTACACCAAGACGTCATCACTGTTGGGTGGGGGAGAGACATTGTTTTATCCTGGTTCATATGTCATCTTCTGGTCTTCAGCTTTTGGAGGCACTGTGTTACCTCCATTGCTCCTGACCTGCCCACGTGGCAGTGTAAGAGTTCATGCTCTGTGCTCCTAAGGAGGTATCTCCACCAGCTTTATCCCTGTTGGCCCAAGCCTGAAGATGAGGAG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Pradip B Devhare et al.
PloS one, 8(5), e63793-e63793 (2013-05-15)
Hepatitis E virus (HEV) is a major cause of enterically transmitted acute hepatitis in developing nations and occurs in sporadic and epidemic forms. The disease may become severe with high mortality (20%) among pregnant women. Due to lack of efficient
Charlotte Odendall et al.
Nature immunology, 15(8), 717-726 (2014-06-24)
Type I interferon responses are considered the primary means by which viral infections are controlled in mammals. Despite this view, several pathogens activate antiviral responses in the absence of type I interferons. The mechanisms controlling type I interferon-independent responses are
Huachen Gan et al.
Scientific reports, 5, 17916-17916 (2015-12-09)
Influenza A virus (IAV) targets airway epithelial cells and exploits the host cell machinery to replicate, causing respiratory illness in annual epidemics and pandemics of variable severity. The high rate of antigenic drift (viral mutation) and the putative antigenic shift

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique