Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU149061

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTTGAAGCAGGACATCAGCATCCCCGACTACTGCAGCCTGGGCGATGGGGAGGAGGAGGAAATCACCATCAATGCCTGGTTTGGTCCCCAGGGAACCATCTCCCCACTACATCAGGATCCCCAGCAAAACTTCCTAGTGCAGGTGATGGGGAGGAAGTACATCCGGCTGTATTCCCCGCAGGAGTCAGGGGCTCTGTACCCTCATGACACGCACCTTCTCCATAACACGAGCCAGGTTGACGTGGAGAATCCCGACCTGGAAAAGTTCCCCAAGTTTGCCAAGGCCCCATTCCTGTCCTGCATCCTGTCTCCTGGAGAGATCCTGTTCATCCCGGTGAAATACTGGCATTACGTGCGGGCTCTGGATTTGAGCTTCTCGGTCAGCTTCTGGTGGTCGTAGCCAGGATAGGAGCTGAAAGGGCCT

Numéro d'accès Ensembl | humain

ENSG00000155666

Numéro d'accès NCBI

NM_001145348

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KDM8(79831) , JMJD5(79831)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Actions biochimiques/physiologiques

JMJD5 (jumonji domain-containing protein 5) exhibits histone H3 lysine 36 dimethylation (H3K36me2) demethylase activity and thereby is associated with gene transcription regulation. In addition, it also has hydroxylase activity and controls osteoclastogenesis. It is linked with cell cycle progression in breast cancer cells, chromosome segregation with the help of RCCD1 (RCC1 domain-containing protein 1), metabolism by controlling PKM2 (pyruvate kinase muscle isozyme) nuclear translocation, microtubule stability and mitotic progression. It also participates in HBV (Hepatitis B virus) replication.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

JMJD5 (Jumonji Domain-containing 5) Associates with Spindle Microtubules and Is Required for Proper Mitosis.
He Z
The Journal of Biological Chemistry, 291, 4684-4684 (2016)
Ru Zhang et al.
International journal of clinical and experimental pathology, 8(6), 6482-6489 (2015-08-12)
To observe the effects of Jumonji C domain-containing (JMJD) 5 depletion on colon cancer (CC). A short-hairpin RNA targeting JMJD5 was transfected into a lentivirus to make Lv-shJMJD5 for infection into the Caco-2 human cell. Besides, a negative control shRNA
Jing Shen et al.
EMBO reports, 18(12), 2131-2143 (2017-10-07)
The histone H3 N-terminal protein domain (N-tail) is regulated by multiple posttranslational modifications, including methylation, acetylation, phosphorylation, and by proteolytic cleavage. However, the mechanism underlying H3 N-tail proteolytic cleavage is largely elusive. Here, we report that JMJD5, a Jumonji C
Takahisa Kouwaki et al.
Journal of virology, 90(7), 3530-3542 (2016-01-23)
Hepatitis B virus (HBV) is a causative agent for chronic liver diseases such as hepatitis, cirrhosis, and hepatocellular carcinoma (HCC). HBx protein encoded by the HBV genome plays crucial roles not only in pathogenesis but also in replication of HBV.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique