Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU119241

Sigma-Aldrich

MISSION® esiRNA

targeting human CAMK4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTTCTTCGCCTCTCACATCCAAACATTATAAAACTTAAAGAGATATTTGAAACCCCTACAGAAATCAGTCTGGTCCTAGAACTCGTCACAGGAGGAGAACTGTTTGATAGGATTGTGGAAAAGGGATATTACAGTGAGCGAGATGCTGCAGATGCCGTTAAACAAATCCTGGAGGCAGTTGCTTATCTACATGAAAATGGGATTGTCCATCGTGATCTCAAACCAGAGAATCTTCTTTATGCAACTCCAGCCCCAGATGCACCACTCAAAATCGCTGATTTTGGACTCTCTAAAATTGTGGAACATCAAGTGCTCATGAAGACAGTATGTGGAACCCCAGGGTACTGCGCACCTGAAATTCTTAGAGGTTGTGCCTATGGACCTGAGGTGGACATGTGGTCTGTAGGAATAATCACCTACATCTTACTTTGTGGATTTGAACCATTCTATGATGAAAGAGGCGATCAGTTCATGTTCAGGAGAATTCTGAATTGTGAATATTACTTTATCTCCCCCTGGTGG

Numéro d'accès Ensembl | humain

ENSG00000152495

Numéro d'accès NCBI

NM_001744

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CAMK4(814) , CAMK4(814)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

DanDan Shi et al.
Inflammation, 41(1), 199-212 (2017-10-04)
The objective of this study is to investigate the role of Calmodulin-dependent protein kinase IV (CaMKIV) in Cardiotoxin (CTX)-induced mice muscle inflammation. CTX injection i.m. was performed to induce B6 mice acute tibialis anterior (TA) muscle injury. The mice were
Kunihiro Ichinose et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(4), 944-952 (2015-12-05)
Kidney podocytes and their slit diaphragms prevent urinary protein loss. T cells from patients with systemic lupus erythematosus display increased expression of calcium/calmodulin-dependent protein kinase IV (CaMKIV). The present study was undertaken to investigate the role of CaMKIV in podocyte
Kayaho Maeda et al.
The Journal of clinical investigation, 128(8), 3445-3459 (2018-07-10)
Podocyte malfunction occurs in autoimmune and nonautoimmune kidney disease. Calcium signaling is essential for podocyte injury, but the role of Ca2+/calmodulin-dependent kinase (CaMK) signaling in podocytes has not been fully explored. We report that podocytes from patients with lupus nephritis
Xueyuan Zhou et al.
Immunology, 143(2), 287-299 (2014-04-30)
Prostaglandin E2 (PGE2 ) is an important inducer of inflammation, which is also closely linked to the progress of tumours. In macrophages, PGE2 production is regulated by arachidonic acid release and cyclooxygenase-2 (COX-2) expression. In the present study, we found

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique