Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU113061

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE3A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTGCTGCTGCTATGGAAGAAGACTCAGAAGCATCTTCCTCAAGGATAGGTGATAGCTCACAGGGAGACAACAATTTGCAAAAATTAGGCCCTGATGATGTGTCTGTGGATATTGATGCCATTAGAAGGGTCTACACCAGATTGCTCTCTAATGAAAAAATTGAAACTGCCTTTCTCAATGCACTTGTATATTTGTCACCTAACGTGGAATGTGACTTGACGTATCACAATGTATACTCTCGAGATCCTAATTATCTGAATTTGTTCATTATCGTAATGGAGAATAGAAATCTCCACAGTCCTGAATATCTGGAAATGGCTTTGCCATTATTTTGCAAAGCGATGAGCAAGCTACCCCTTGCAGCCCAAGGAAAACTGATCAGACTGTGGTCTAAATACAATGCAGACCAGATTCGGAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Imran Jamal et al.
Neurobiology of disease, 105, 99-108 (2017-06-04)
Angelman syndrome (AS) is a neurodevelopmental disorder characterized by severe intellectual and developmental disabilities. The disease is caused by the loss of function of maternally inherited UBE3A, a gene that exhibits paternal-specific imprinting in neuronal tissues. Ube3a-maternal deficient mice (AS
Tsubasa Munakata et al.
PLoS pathogens, 3(9), 1335-1347 (2007-10-03)
Hepatitis C virus (HCV) is a positive-strand RNA virus that frequently causes persistent infections and is uniquely associated with the development of hepatocellular carcinoma. While the mechanism(s) by which the virus promotes cancer are poorly defined, previous studies indicate that
Yanfei Li et al.
Acta biochimica et biophysica Sinica, 52(1), 58-63 (2019-11-05)
Cardiac hypertrophy is considered to be a leading factor in heart function-related deaths. In this study, we explored the potential mechanism underlying cardiac hypertrophy induced by isoproterenol. Our results showed that isoproterenol induced cardiac hypertrophy in AC16 cells, as reflected
Fei Zhang et al.
Journal of orthopaedic surgery and research, 12(1), 103-103 (2017-07-07)
Osteosarcoma (OS) is one of the most common malignant tumors developed in the bone. EZH2 has been found to play pivotal roles in the development of various cancers. LncRNA-ANCR (anti-differentiation ncRNA) has been reported to interact with EZH2 and regulated
Dohun Pyeon et al.
Viruses, 11(12) (2019-12-01)
Molecular basis of HIV-1 life cycle regulation has thus far focused on viral gene stage-specificity, despite the quintessence of post-function protein elimination processes in the virus life cycle and consequent pathogenesis. Our studies demonstrated that a key pathogenic HIV-1 viral

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique