Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU091111

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2K

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCGCACGGTATTATTGTCATTGCAAGCACTATTGGCAGCTGCAGAGCCAGATGATCCACAGGATGCTGTAGTAGCAAATCAGTACAAACAAAATCCCGAAATGTTCAAACAGACAGCTCGACTTTGGGCACATGTGTATGCTGGAGCACCAGTTTCTAGTCCAGAATACACCAAAAAAATAGAAAACCTATGTGCTATGGGCTTTGATAGGAATGCAGTAATAGTGGCCTTGTCTTCAAAATCATGGGATGTAGAGACTGCAACAGAATTGCTTCTGAGTAACTGAGGCATAGAGAGCTGCTGATATAGTCAAGCTTGCCTCTTCTTGAGGAGCACCAACATCTGTTATTTTTAGGATTCTGCATAGATTTCTTTTAAACTGGCATTCTTGCCTAATGATGTTATCTAGGCACCATTGGAGACTG

Numéro d'accès Ensembl | humain

ENSG00000078140

Numéro d'accès NCBI

NM_005339

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... UBE2K(3093) , UBE2K(3093)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Eun Il Jeong et al.
Cell death & disease, 7(12), e2573-e2573 (2016-12-30)
Cerebral ischemia/reperfusion (I/R) causes brain damage accompanied by ubiquitin accumulation and impairment of proteasome activity. In this study, we report that E2-25K, an E2-conjugating enzyme, is SUMOylated during oxidative stress and regulates cerebral I/R-induced damage. Knockdown of E2-25K expression protects
Lisa Schmölz et al.
Biochimica et biophysica acta, 1863(8), 919-927 (2018-05-08)
The long-chain metabolites of vitamin E (LCM) emerge as a new class of regulatory metabolites and have been considered as the active compounds formed during vitamin E metabolism. The bioactivity of the LCM is comparable to the already established role
Wen-Bin Gu et al.
Developmental and comparative immunology, 101, 103452-103452 (2019-07-19)
NFIL3 is a transcriptional activator of the IL-3 promoter in T cells. In vertebrates, it has been characterized as an essential regulator of several cellular processes such as immunity response, apoptosis and NK cells maturation. However, the identification and functional

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique