Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU076241

Sigma-Aldrich

MISSION® esiRNA

targeting human ERG

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGGGGAAGAGATCCAAAGACTCTTGGGAGGGAGTTACTGAAGTCTTACTACAGAAATGAGGAGGATGCTAAAAATGTCACGAATATGGACATATCATCTGTGGACTGACCTTGTAAAAGACAGTGTATGTAGAAGCATGAAGTCTTAAGGACAAAGTGCCAAAGAAAGTGGTCTTAAGAAATGTATAAACTTTAGAGTAGAGTTTGGAATCCCACTAATGCAAACTGGGATGAAACTAAAGCAATAGAAACAACACAGTTTTGACCTAACATACCGTTTATAATGCCATTTTAAGGAAAACTACCTGTATTTAAAAATAGAAACATATCAAAAACAAGAGAAAAGACACGAGAGAGACTGTGGCCCATCAACAGACGTTGATATGCAACTGCATGGCATGTGCTGTTTTGGTTGAAATCAAATACATTCCGTTTGATGGACAGCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Rohit Bose et al.
Nature, 546(7660), 671-675 (2017-06-15)
Half of all prostate cancers are caused by the TMPRSS2-ERG gene-fusion, which enables androgens to drive expression of the normally silent E26 transformation-specific (ETS) transcription factor ERG in prostate cells. Recent genomic landscape studies of such cancers have reported recurrent
Ahmed A Mohamed et al.
Molecular cancer research : MCR, 15(10), 1308-1317 (2017-06-14)
The oncogenic activation of the ETS-related gene (
Jung-Sun Kim et al.
Endocrinology, 155(9), 3262-3273 (2014-06-14)
A number of preclinical studies have shown that the activation of the vitamin D receptor (VDR) reduces prostate cancer (PCa) cell and tumor growth. The majority of human PCas express a transmembrane protease serine 2 (TMPRSS2):erythroblast transformation-specific (ETS) fusion gene
J Kim et al.
Oncogene, 33(44), 5183-5192 (2013-11-05)
Chromosomal translocations that juxtapose the androgen-sensitive transmembrane protease, serine 2 (TMPRSS2) gene promoter to the oncogenic ETS-family transcription factor ERG result in excessive ERG overexpression in approximately 50% of prostate cancer (PCa) patients. Although numerous studies have investigated ERG-downstream genes
Chun-Wu Pan et al.
Theranostics, 11(4), 1780-1794 (2021-01-08)
Rationale: Enhancer RNA (eRNA) bi-directionally expresses from enhancer region and sense eRNA regulates adjacent mRNA in cis and in trans. However, it has remained unclear whether antisense eRNAs in different direction are functional or merely a reflection of enhancer activation.

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique