Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU074041

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKAA1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCTCAGAAGAGGAAGTTCTCAGCTGTCTTTACAACAGAAATCACCAGGATCCTTTGGCAGTTGCCTACCATCTCATAATAGATAACAGGAGAATAATGAATGAAGCCAAAGATTTCTATTTGGCGACAAGCCCACCTGATTCTTTTCTTGATGATCATCACCTGACTCGGCCCCATCCTGAAAGAGTACCATTCTTGGTTGCTGAAACACCAAGGGCACGCCATACCCTTGATGAATTAAATCCACAGAAATCCAAACACCAAGGTGTAAGGAAAGCAAAATGGCATTTAGGAATTAGAAGTCAAAGTCGACCAAATGATATTATGGCAGAAGTATGTAGAGCAATCAAACAATTGGATTATGAATGGAAGGTTGTAAACCCATATTATTTGCGTGTACGAAGGAAGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Cuiping Dai et al.
Oncotarget, 8(56), 95810-95823 (2017-12-10)
LB-100 is a novel PP2A inhibitor. Its activity in human colorectal cancer (CRC) cells was tested. The
Takuma Hashimoto et al.
Biochemical and biophysical research communications, 505(1), 13-19 (2018-09-19)
Solid tumors often contain hypoxic regions because an abnormal and inefficient tumor vasculature is unable to supply sufficient oxygen. Tissue hypoxia is generally defined as a low oxygen concentration of less than 2%. It is well known that tumor cells
You-Li Yao et al.
Toxicology letters, 281, 127-138 (2017-10-02)
The aim of this study was to investigate the effects of acanthoic acid (AA) on the regulation of inflammatory response, lipid accumulation, and fibrosis via AMPK- IRAK4 signaling against chronic alcohol consumption in mice. Ethanol-induced liver injury was induced in
Vanessa Zurli et al.
Science signaling, 13(631) (2020-05-14)
Understanding the costimulatory signaling that enhances the activity of cytotoxic T cells (CTLs) could identify potential targets for immunotherapy. Here, we report that CD2 costimulation plays a critical role in target cell killing by freshly isolated human CD8+ T cells
Ying-Nan Wang et al.
Oncogene, 39(3), 637-650 (2019-09-19)
Patients with stage II or III colorectal cancer (CRC) exhibit various clinical outcomes after radical treatments. The 5-year survival rate was between 50 and 87%. However, the underlying mechanisms of the variation remain unclear. Here we show that AMPKα1 is

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique