Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU024581

Sigma-Aldrich

MISSION® esiRNA

targeting human PDCD6IP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAAAGCCACACTTGTGAAATCTACCCCGGTCAATGTACCCATCAGTCAGAAATTTACTGATCTGTTTGAGAAGATGGTTCCCGTGTCAGTACAGCAGTCTTTGGCTGCCTATAATCAGAGGAAAGCCGATTTGGTTAACAGATCAATTGCTCAGATGAGAGAAGCCACCACTTTGGCAAATGGGGTGCTAGCTTCCCTTAATCTTCCAGCAGCAATTGAAGATGTGTCTGGAGACACTGTACCTCAGTCTATATTGACTAAATCCAGATCTGTGATTGAACAGGGAGGCATCCAGACTGTTGATCAGTTGATTAAAGAACTGCCTGAATTACTGCAACGAAATAGAGAAATCCTAGATGAGTCATTAAGGTTGTTGGATGAAGAAGAAGCAACCGATAATGATTTAAGAGCAAAATTTAAGGAACGTTGGCAAAGGACACCATCCAATGAACTGTATAAGCCTTTAAGAGCAGAGGGAACCAACTTCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Julianne V de Carvalho et al.
PloS one, 9(11), e113691-e113691 (2014-11-26)
Nef is an HIV-1 accessory protein that promotes viral replication and pathogenesis. A key function of Nef is to ensure sustained depletion of CD4 and MHC-I molecules in infected cells by inducing targeting of these proteins to multivesicular bodies (MVBs)
Li Zhong et al.
Signal transduction and targeted therapy, 6(1), 59-59 (2021-02-12)
It remains unknown for decades how some of the therapeutic fusion proteins positive in a small percentage of cancer cells account for patient outcome. Here, we report that osteosarcoma Rab22a-NeoF1 fusion protein, together with its binding partner PYK2, is sorted
Allaura S Cone et al.
BMC molecular and cell biology, 21(1), 58-58 (2020-08-01)
Endosomal trafficking and amyloidogenic cleavage of amyloid precursor protein (APP) is believed to play a role in the neurodegeneration observed in Alzheimer's disease (AD). Recent evidence has suggested that packaging and secretion of APP and its amyloidogenic cleaved products into
Brian A Davies et al.
Molecular biology of the cell, 31(22), 2463-2474 (2020-08-28)
Intercellular communication is critical for organismal homeostasis, and defects can contribute to human disease states. Polarized epithelial cells execute distinct signaling agendas via apical and basolateral surfaces to communicate with different cell types. Small extracellular vesicles (sEVs), including exosomes and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique