Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU016891

Sigma-Aldrich

MISSION® esiRNA

targeting human SERPINE1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGGTTCTGCCCAAGTTCTCCCTGGAGACTGAAGTCGACCTCAGGAAGCCCCTAGAGAACCTGGGAATGACCGACATGTTCAGACAGTTTCAGGCTGACTTCACGAGTCTTTCAGACCAAGAGCCTCTCCACGTCGCGCAGGCGCTGCAGAAAGTGAAGATCGAGGTGAACGAGAGTGGCACGGTGGCCTCCTCATCCACAGCTGTCATAGTCTCAGCCCGCATGGCCCCCGAGGAGATCATCATGGACAGACCCTTCCTCTTTGTGGTCCGGCACAACCCCACAGGAACAGTCCTTTTCATGGGCCAAGTGATGGAACCCTGACCCTGGGGAAAGACGCCTTCATCTGGGACAAAACTGGAGATGCATCGGGAAAGAAGAAACTCCGAAGAAAAGAATTTTAGTGTTAATGACTCTTTCTGAAGGAAGAGAAGACATTTGCCTTTTGTTAAAAGATGGTAAACCAGATCTGTCTCCAAGACCTTGGCCTCTCCTTGGAGGACCTTT

Numéro d'accès Ensembl | humain

ENSG00000106366

Numéro d'accès NCBI

NM_000602

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SERPINE1(5054) , SERPINE1(5054)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hyeon-Joon Kong et al.
International journal of oncology, 58(1), 111-121 (2020-12-29)
Serpin family E member 1 (SERPINE1), a serine proteinase inhibitor, serves as an important regulator of extracellular matrix remodeling. Emerging evidence suggests that SERPINE1 has diverse roles in cancer and is associated with poor prognosis. However, the mechanism via which SERPINE1 is induced
En-Dong Zhu et al.
PloS one, 9(8), e106049-e106049 (2014-08-30)
Gastric cancer is one of the most common malignant diseases worldwide. Emerging evidence has shown that microRNAs (miRNAs) are associated with tumor development and progression. Our previous studies have revealed that H. pylori infection was able to induce the altered
Amanda M Rampersaud et al.
Molecular human reproduction, 26(11), 850-865 (2020-09-09)
A critical component of early human placental development includes migration of extravillous trophoblasts (EVTs) into the decidua. EVTs migrate toward and displace vascular smooth muscle cells (SMCs) surrounding several uterine structures, including spiral arteries. Shallow trophoblast invasion features in several
Mike R Wilson et al.
Cell reports, 33(6), 108366-108366 (2020-11-12)
Endometriosis affects 1 in 10 women and is characterized by the presence of abnormal endometrium at ectopic sites. ARID1A mutations are observed in deeply invasive forms of the disease, often correlating with malignancy. To identify epigenetic dependencies driving invasion, we
Ruozhi Zhao et al.
Journal of leukocyte biology, 95(6), 941-949 (2014-02-06)
Diabetes mellitus accelerates the development of atherosclerotic cardiovascular diseases. Monocyte adhesion is an early cellular event of atherogenesis. Elevated levels of glyLDL were common in diabetic patients. Our previous studies indicated that HSF1 and p22-phox (a subunit of the NOX

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique