Anmelden zur Ansicht der Organisations- und Vertragspreise.
Größe auswählen
Über diesen Artikel
NACRES:
NA.51
UNSPSC Code:
12352200
Technischer Dienst
Benötigen Sie Hilfe? Unser Team von erfahrenen Wissenschaftlern ist für Sie da.
Unterstützung erhaltenTechnischer Dienst
Benötigen Sie Hilfe? Unser Team von erfahrenen Wissenschaftlern ist für Sie da.
Unterstützung erhaltenproduct line
MISSION®
form
solid
mature sequence
AAGCCCUUACCCCAAAAAGCAU
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
General description
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Other Notes
Based on miRBase V19
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
signalword
Warning
hcodes
pcodes
Hazard Classifications
STOT RE 2 Inhalation
target_organs
Respiratory Tract
Lagerklasse
11 - Combustible Solids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Hier finden Sie alle aktuellen Versionen:
Besitzen Sie dieses Produkt bereits?
In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.
Mukul Godbole et al.
Cancer biology & therapy, 18(10), 801-805 (2017-09-07)
Hormonal therapy is an important component of first line of treatment for breast cancer. Response to hormonal therapy is influenced by the progesterone receptor (PR)-status of breast cancer patients. However as an early effect, exposure to progesterone decreases expression of
Verwandter Inhalt
Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..
Setzen Sie sich mit dem technischen Dienst in Verbindung