Direkt zum Inhalt
Merck

EMU216481

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vcan

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTCATAGCAAGCCCAGAGCAGCTGTTTGCCGCCTATGAGGATGGATTTGAGCAGTGTGATGCAGGATGGCTGTCTGATCAAACTGTCAGATATCCCATACGGGCTCCCCGAGAGGGCTGTTACGGAGACATGATGGGGAAGGAAGGGGTTCGGACCTATGGATTCCGCTCTCCCCAGGAAACCTATGATGTGTATTGTTATGTGGATCATCTGGATGGCGATGTGTTCCACATCACTGCTCCCAGTAAGTTCACCTTCGAGGAGGCCGAAGCAGAGTGTACAAGCAGGGATGCGAGGCTGGCGACTGTTGGAGAACTTCAGGCAGCTTGGAGAAATGGCTTTGACCAATGCGATTACGGCTGGCTGTCGGATGCCAGCGTGCGGCACCCTGTGACTGTGGCCAGGGCCCAGTGTGGAGGAGGTCTACTTGGGGTGAGAACCCTGTATCGTTTTGAGAACCAGACATGCTTCCCTCTCCCTGATAGCAGATTTGATGCCTACTGCTTTAAA

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lu-lu Xu et al.
Respiratory physiology & neurobiology, 215, 58-63 (2015-05-23)
COPD lung is characterized by loss of alveolar elastic fibers and an increase in the chondroitin sulfate (CS) matrix proteoglycan versican V1 (V1). V1 is a known inhibitor of elastic fiber deposition and this study investigates the effects of knockdown
Zi Wang et al.
Oncology reports, 33(6), 2981-2991 (2015-04-16)
The systematic application of antiangiogenic therapy remains an issue of concern, mainly due to the hypoxic and inflammatory changes in the tumor microenvironment elicited by antiangiogenic therapy. Versican, a 'bridge' connecting inflammation with tumor progression as well as playing a
Naoko Arichi et al.
Oncoscience, 2(2), 193-204 (2015-04-11)
In the current study, we investigated a combination of docetaxel and thalidomide (DT therapy) in castration-resistant prostate cancer (CRPC) patients. We identified marker genes that predict the effect of DT therapy. Using an androgen-insensitive PC3 cell line, we established a
Pamela A Havre et al.
BMC cancer, 13, 517-517 (2013-11-05)
CD26/dipeptidyl peptidase IV (DPPIV) is a multifunctional membrane protein with a key role in T-cell biology and also serves as a marker of aggressive cancers, including T-cell malignancies. Versican expression was measured by real-time RT-PCR and Western blots. Gene silencing
Jon M Carthy et al.
Cardiovascular pathology : the official journal of the Society for Cardiovascular Pathology, 24(6), 368-374 (2015-09-24)
Versican is a versatile and highly interactive chondroitin sulfate proteoglycan that is found in the extracellular matrix (ECM) of many tissues and is a major component of developing and developed lesions in atherosclerotic vascular disease. In this paper, we present

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.