Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EMU057611

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Notch1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCCAACCCATGTCAGAATGATGCCACTTGCCTGGACCAGATTGGGGAGTTCCAATGCATATGTATGCCAGGTTATGAAGGTGTATACTGTGAAATCAACACGGATGAGTGCGCCAGCAGCCCCTGTCTGCACAATGGCCACTGCATGGACAAGATCAATGAGTTCCAATGTCAGTGCCCCAAAGGCTTCAACGGGCACCTGTGCCAGTATGATGTGGATGAGTGTGCCAGCACACCATGCAAGAACGGTGCCAAGTGCCTGGATGGGCCCAACACCTATACCTGCGTGTGTACAGAAGGTTACACAGGGACCCACTGCGAAGTGGACATTGACGAGTGTGACCCTGACCCCTGCCACTATGGTTCCTGTAAGGATGGTGTGGCCACCTTTACCTGCCTGTGCCAGCCAGGCTACACAGGCCATCACTGTGAGACCAACATCAATGAGTGCCACAGCCAACCGTGCCGCCATGGGGGCACCTGCCAGGACCGTGACAACTCCTACCTCTGCTTATGCCTCAAGG

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000026923

NCBI-Hinterlegungsnummer

NM_008714

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... NOTCH1(18128) , Notch1(18128)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though
Debarshi Banerjee et al.
Cancer research, 75(8), 1592-1602 (2015-03-07)
The Notch pathway plays multiple key roles in tumorigenesis, and its signaling components have therefore aroused great interest as targets for emerging therapies. Here, we show that inhibition of Notch, using a soluble receptor Notch1 decoy, unexpectedly caused a remarkable
Yinan Liu et al.
PloS one, 9(10), e109588-e109588 (2014-10-15)
The Notch signaling pathway plays versatile roles during heart development. However, there is contradictory evidence that Notch pathway either facilitates or impairs cardiomyogenesis in vitro. In this study, we developed iPSCs by reprogramming of murine fibroblasts with GFP expression governed
Guanqiao Wang et al.
Cellular signalling, 27(7), 1369-1379 (2015-04-07)
Carbonic anhydrase IX(CA9)is a member of the carbonic anhydrase family that catalyzes the reversible hydration of carbon dioxide, and plays a key role in the regulation of pH. Although a large number of studies have shown that CA9 is strongly
Le Kang et al.
Cancer science, 106(6), 700-708 (2015-03-19)
MicroRNAs play pivotal roles in cancer stem cell regulation. Previous studies have shown that microRNA-34a (miR-34a) is downregulated in human breast cancer. However, it is unknown whether and how miR-34a regulates breast cancer stem cells. Notch signaling is one of
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.