Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EMU021051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tnfrsf10b

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCAGTGCGTTTGAAGTCAGCCTGATCTACTTAGTGAACTCAGGACAGCCAAGGCTATGTAGAGAGCCCCGAAGATGCAGGCTCTTCAGTATTATGAGAATGTACTTAATTTTTTCTTGTAGTAGTTAGTGTATCATATTATTGTATTATTTATATTATTACTGTTAAGTACTATGTTCTCTTATTAGAAGTTGAACACAGAACCTCTGAGAACACATATGCTACAAGTGTTCTAACACACCTCCAGCATCCCGGATTACCTTTGTTCCTGAACAAGGCACAATTGGTAGGGTATGATAGGGCCTGCCTATCATCCTAACACTCCGGTGATGGAGCCAGGAAGATCAAGAGTTCGAGGCCAGCTGGTTCACATAAGATCCCATATAATGTGCAGGATGGCTAAACTTGCTGAGAGCTGACTCTGTGGTCTCCTGTCCCAGATTC

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000022074

NCBI-Hinterlegungsnummer

NM_020275

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... TNFRSF10B(21933) , Tnfrsf10b(21933)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hemn Mohammadpour et al.
Photodiagnosis and photodynamic therapy, 12(2), 238-243 (2015-02-28)
Mesenchymal stem cells are multi-potent progenitor cells that inhibit tumor growth by some ligands and releasing factors including TRAIL, DKK-1 and DKK-3. On other hands, photodynamic therapy is commonly used for treatment of different types of cancer. The aims of
Deokil Shin et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(3), 1151-1162 (2015-06-27)
Although Vitisin A, derived from wine grapes, is known to have cytotoxic, anti-adipogenic, anti-inflammatory and antioxidant effects, the underlying antitumor mechanism has not been investigated in prostate cancer cells to date. In the present study, the apoptotic mechanism of Vitisin
Huilian Huang et al.
Clinical laboratory, 61(10), 1501-1508 (2015-12-09)
Mounting evidence indicates that nuclear targeting by growth factors plays an indispensable role on their biological activities. Midkine (MK) is a multifunctional growth factor and has been discovered to play important roles in carcinogenesis. MK has been reported to localize
Seon Min Woo et al.
Oncotarget, 6(13), 11614-11626 (2015-04-07)
FTY720, Fingolimod, is a functional antagonist to the sphingosine-1-phosphate (S1P) receptor and an inhibitor of sphingosine kinase 1. Here, we showed that a combination of FTY720 and TRAIL induced apoptosis in human renal, breast, and colon carcinoma cells. Most importantly
Jiahe Li et al.
Scientific reports, 5, 9987-9987 (2015-05-20)
Malignant transformation results in increased levels of reactive oxygen species (ROS). Adaption to this toxic stress allows cancer cells to proliferate. Recently, piperlongumine (PL), a natural alkaloid, was identified to exhibit novel anticancer effects by targeting ROS signaling. PL induces

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.