Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EMU011371

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Map2k2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGGCCAACTCGTTTGTAGGGACGCGCTCCTACATGTCCCCAGAGCGGCTGCAGGGCACCCACTACTCTGTGCAGTCGGACATCTGGAGCATGGGGCTGTCGCTGGTGGAGCTGGCCATCGGGAGGTATCCCATTCCCCCACCTGATGCCAAGGAACTAGAGGCCAGCTTTGGCCGGCCTGTGGTGGACGGGGCAGACGGAGAACCCCATAGTGTCTCCCCGAGGCCCAGGCCCCCTGGACGCCCCATCAGTGTAGGTCATGGGATGGACAGCCGACCGGCCATGGCCATCTTTGAGCTGCTGGACTACATAGTGAACGAGCCACCTCCCAAGCTGCCCAGTGGTGTGTTCAGCTCAGACTTCCAGGAGTTTGTGAATAAATGTCTCATTAAGAACCCAGCAGAGCGAGCAGATCTGAAGC

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000035027

NCBI-Hinterlegungsnummer

NM_023138

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... MAP2K2(26396) , Map2k2(26396)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number
KPT
AOR

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Suche nach COA

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Sara Alves et al.
Oncotarget, 6(31), 30787-30802 (2015-09-30)
The recent interest to modulate autophagy in cancer therapy has been hampered by the dual roles of this conserved catabolic process in cancer, highlighting the need for tailored approaches. Since RAS isoforms have been implicated in autophagy regulation and mutation
Simona Gargiulo et al.
International journal of molecular sciences, 13(11), 14278-14293 (2012-12-04)
The hypercholesterolemia-atherosclerosis association is now established; hypercholesterolemia may induce vascular-cell activation, subsequently increasing expression of adhesion molecules, cytokines, chemokines, growth factors, and other key inflammatory molecules. Among inflammatory molecules expressed by vascular cells, integrins play a critical role in regulating
Lei-Lei Chen et al.
Autophagy, 13(11), 1969-1980 (2017-09-22)
Recent studies have demonstrated that dysregulation of macroautophagy/autophagy may play a central role in the pathogenesis of neurodegenerative disorders, and the induction of autophagy protects against the toxic insults of aggregate-prone proteins by enhancing their clearance. Thus, autophagy has become
Caroline N Mills et al.
Molecular cancer, 8, 104-104 (2009-11-19)
Hypoxia inducible factor-1 alpha (HIF-1alpha) protein is rapidly degraded under normoxic conditions. When oxygen tensions fall HIF-1alpha protein stabilizes and transactivates genes involved in adaptation to hypoxic conditions. We have examined the normoxic expression of HIF-1alpha RNA and protein in
Kazutaka Nanba et al.
Endocrinology, 156(5), 1750-1756 (2015-02-14)
There is considerable evidence supporting the role of calcium signaling in adrenal regulation of both aldosterone synthase (CYP11B2) and aldosterone production. However, there have been no studies that investigated the role played by the Ca(2+)/calmodulin-dependent protein kinase kinase (CaMKK) in
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.