Direkt zum Inhalt
Merck

EMU003641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atp6ap2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCTCTTTCTCTCCGAACTGCAAGTGCTACATGATATTTCCAGTTTGTTGTCTCGTCATAAGCATCTAGCCAAGGACCATTCACCCGACTTGTATTCATTGGAGCTGGCAGGTTTGGATGAACTTGGGAAGCGTTATGGGGAAGACTCTGAACAGTTCAGGGATGCTTCTAAGATCCTTGTTGATGCTCTCCAAAAGTTTGCAGATGACATGTACAGTCTCTATGGTGGGAACGCAGTGGTAGAGTTAGTGACTGTCAAATCATTCGACACATCCCTTGTGAGGAAGTCAAGGACCATCCTTGAGGCAAAACAAGAGAACACCCAAAGTCCTTATAACCTTGCATATAAGTATAATTTGGAGTATTCAGTGGTTTTCAACTTGGTACTGTGGATTATGATCGGCTTG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Wendy W Batenburg et al.
PloS one, 9(6), e100954-e100954 (2014-06-27)
Dysfunction of renin-angiotensin system (RAS) contributes to the pathogenesis of diabetic retinopathy (DR). Prorenin, the precursor of renin is highly elevated in ocular fluid of diabetic patients with proliferative retinopathy. Prorenin may exert local effects in the eye by binding
Joseph C K Leung et al.
Apoptosis : an international journal on programmed cell death, 20(7), 907-920 (2015-03-27)
Glomerulo-podocytic communication plays an important role in the podocytic injury in IgA nephropathy (IgAN). In this study, we examine the role of podocytic angiotensin II receptor subtype 1 (AT1R) and prorenin receptor (PRR) in podocytic apoptosis in IgAN. Polymeric IgA
Feng Y Liu et al.
Journal of the renin-angiotensin-aldosterone system : JRAAS, 15(2), 99-108 (2014-03-05)
Since the discovery of the (pro)renin receptor (PRR), it has been considered as a novel bioactive molecule of the renin-angiotensin system (RAS). The activation of PRR can elicit a series of angiotensin II (AngII)-independent effects. In this study, we investigated
Caixia Li et al.
American journal of physiology. Endocrinology and metabolism, 309(3), E302-E310 (2015-06-18)
High glucose reduces autophagy and enhances apoptosis of podocytes. Previously, we reported that high glucose induced podocyte injury through upregulation of the (pro)renin receptor (PRR). We hypothesized that increasing PRR reduces autophagy and increases apoptosis of mouse podocytes exposed to

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.