Direkt zum Inhalt
Merck

EHU158111

Sigma-Aldrich

MISSION® esiRNA

targeting human TIA1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCCCGCTCCAAAGAGTACATATGAGTCAAATACCAAACAGCTATCATATGATGAGGTTGTAAATCAGTCTAGTCCAAGCAACTGTACTGTATACTGTGGAGGTGTTACTTCTGGGCTAACAGAACAACTAATGCGTCAGACTTTTTCACCATTTGGACAAATAATGGAAATTCGAGTCTTTCCAGATAAAGGATATTCATTTGTTCGGTTCAATTCCCATGAAAGTGCAGCACATGCAATTGTTTCTGTTAATGGTACTACCATTGAAGGTCATGTTGTGAAATGCTATTGGGGCAAAGAAACTCTTGATATGATAAATCCCGTGCAACAGCAGAATCAAATTGGATATCCCCAACCTTATGGCCAGTGGGGCCAGTGGTATGGAAATGCACAACAAATTGGCCAGTA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yuzo Abe et al.
Cell & bioscience, 11(1), 122-122 (2021-07-05)
Tumor protein D52 (TPD52) reportedly plays an important role in the proliferation and metastasis of various cancer cells, including oral squamous cell carcinoma (OSCC) cells, and is expressed strongly at the center of the tumor, where the microenvironment is hypoxic.
Xuefeng Yang et al.
Biochimie, 154, 119-126 (2018-08-26)
Gastric cancer (GC) is one of the most common malignancies as well as the third leading cause for cancer-related death. Molecular basis of GC are essential and critical for its therapeutic treatment, but still remain poorly understood. T-cell intracellular antigen-1
Jovan Nikolic et al.
PLoS pathogens, 12(10), e1005942-e1005942 (2016-10-18)
Stress granules (SGs) are membrane-less dynamic structures consisting of mRNA and protein aggregates that form rapidly in response to a wide range of environmental cellular stresses and viral infections. They act as storage sites for translationally silenced mRNAs under stress
Alice Pasini et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1861(5), 463-472 (2018-03-21)
Cyclooxygenase-2 (COX-2), with its main antifibrotic metabolite PGE2, is regarded as an antifibrotic gene. Repressed COX-2 expression and deficient PGE2 have been shown to contribute to the activation of lung fibroblasts and excessive deposition of collagen in pulmonary fibrosis. We

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.