Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU153671

Sigma-Aldrich

MISSION® esiRNA

targeting human PTX3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATTCAGAGGAAGGGCTCACATCCTTGTGGGTAAATGGTGAACTGGCGGCTACCACTGTTGAGATGGCCACAGGTCACATTGTTCCTGAGGGAGGAATCCTGCAGATTGGCCAAGAAAAGAATGGCTGCTGTGTGGGTGGTGGCTTTGATGAAACATTAGCCTTCTCTGGGAGACTCACAGGCTTCAATATCTGGGATAGTGTTCTTAGCAATGAAGAGATAAGAGAGACCGGAGGAGCAGAGTCTTGTCACATCCGGGGGAATATTGTTGGGTGGGGAGTCACAGAGATCCAGCCACATGGAGGAGCTCAGTATGTTTCATAAATGTTGTGAAACTCCACTTGAAGCCAAAGAAAGAAACTCACACTTAAAACACATGCCAGTTGGGAAGGTCTGAAAACTCAGTGCATAATAGGAACACTTGAGACTAATGAAAGAGAGAGTTGAGACCAATCTTTATTTGTACTGGCCAAATACTGAATAAACAGTTGAAGGAAAGACATTGGAAAAAGCTTTTGAGGATAATGTTACTAGACTTTATGCCATGGTGCTTTCA

Ensembl | Human Hinterlegungsnummer

ENSG00000163661

NCBI-Hinterlegungsnummer

NM_002852

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... PTX3(5806) , PTX3(5806)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Christina L O'Neill et al.
Cardiovascular research, 112(3), 677-688 (2016-09-24)
Circulating angiogenic cells (CACs) promote revascularization of ischaemic tissues although their underlying mechanism of action and the consequences of delivering varying number of these cells for therapy remain unknown. This study investigates molecular mechanisms underpinning CAC modulation of blood vessel
Xian-Yuan Luo et al.
Cell biology international (2018-05-10)
MicroRNAs (miRNAs) have been known to function as important regulators in the vascular system, with various physiopathological effects such as vascular remodeling and hypertension modulation. We aimed to explore whether microRNA-150 (miR-150) regulates endothelial cell function and vascular remodeling in
Shih-Hung Chan et al.
Oncotarget, 8(25), 41364-41378 (2017-05-11)
The association between metabolic diseases and the risk of developing cancer is emerging. However, the impact of long pentraxin-3 (PTX3) on dyslipidemia-associated tumor metastasis remains unknown. In this study, we found that oleate induced PTX3 expression and secretion through the
Hyeon Joo Ham et al.
Journal of neuroinflammation, 17(1), 350-350 (2020-11-24)
Alzheimer's disease (AD) is one of the most prevalent neurodegenerative disorders characterized by gradual memory loss and neuropsychiatric symptoms. We have previously demonstrated that the 2-({3-[2-(1-cyclohexene-1-yl)ethyl]-6,7-dimethoxy-4-oxo-3,4-dihydro-2-quinazolinyl}sulfanyl)-N-(4-ethylphenyl)butanamide (K284-6111), the inhibitor of CHI3L1, has the inhibitory effect on memory impairment in Αβ
Peiyuan Zhang et al.
Nature communications, 11(1), 2487-2487 (2020-05-20)
Cancer stem-like cells (CSCs) are the tumorigenic cell subpopulation and contribute to cancer recurrence and metastasis. However, the understanding of CSC regulatory mechanisms remains incomplete. By transcriptomic analysis, we identify a scaffold protein SH3RF3 (also named POSH2) that is upregulated

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.