Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU145491

Sigma-Aldrich

MISSION® esiRNA

targeting human MEF2D

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCCACTGCCTACAACACAGATTACCAGTTGACCAGTGCAGAGCTCTCCTCCTTACCAGCCTTTAGTTCACCTGGGGGGCTGTCGCTAGGCAATGTCACTGCCTGGCAACAGCCACAGCAGCCCCAGCAGCCGCAGCAGCCACAGCCTCCACAGCAGCAGCCACCGCAGCCACAGCAGCCACAGCCACAGCAGCCTCAGCAGCCGCAACAGCCACCTCAGCAACAGTCCCACCTGGTCCCTGTATCTCTCAGCAACCTCATCCCGGGCAGCCCCCTGCCCCACGTGGGTGCTGCCCTCACAGTCACCACCCACCCCCACATCAGCATCAAGTCAGAACCGGTGTCCCCAAGCCGTGAGCGCAGCCCTGCGCCTCCCCCTCCAGCTGTGTTCCCAGCTGCCCGCCCTGAGCCTGGCGATGGTCTCAGCAGCCCAGCCGGGGGATCCTATGAGACGGGAGACCGGGATGACGGACGGGGGGACTTCGGGCCCACACTGGGCCTGCTGCGCCCAGCCCCAGAGCCTGAGGCTGAGGGCTCAGCTGTGAAGAGGATGCGGCTTGATA

Ensembl | Human Hinterlegungsnummer

ENSG00000116604

NCBI-Hinterlegungsnummer

NM_005920

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... MEF2D(4209) , MEF2D(4209)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Shuna Li et al.
Aging, 12(7), 6456-6466 (2020-04-10)
Cochlear ribbon synapses play a pivotal role in the prompt and precise acoustic signal transmission from inner hair cells (IHCs) to the spiral ganglion neurons, while noise and aging can damage ribbon synapses, resulting in sensorineural hearing loss. Recently, we
Yaru Dong et al.
Neurochemical research, 46(2), 299-308 (2020-11-13)
Parkinson's disease (PD) is a severe neurodegenerative disease characterized by selective loss of dopaminergic neurons, which reduces quality of life of patients and poses a heavy burden to the society. The pathological mechanism of PD remains unclear, and increasing efforts
Zhi-Qin Hu et al.
Oncotarget, 8(54), 92079-92089 (2017-12-02)
The role of microRNA-92b-3p (miR-92b-3p) in cardiac hypertrophy was not well illustrated. The present study aimed to investigate the expression and potential target of miR-92b-3p in angiotensin II (Ang-II)-induced mouse cardiac hypertrophy. MiR-92b-3p was markedly decreased in the myocardium of
Haiyun Chen et al.
Aging, 12(14), 14897-14917 (2020-07-28)
T-006, a new derivative of tetramethylpyrazine, has been recently found to protect against 6-hydroxydopamine (6-OHDA)-induced neuronal damage and clear α-synuclein (α-syn) by enhancing proteasome activity in an α-syn transgenic Parkinson's disease (PD) model. The effect of T-006 on the 1-methyl-4-phenyl-1
Jung-Hwa Han et al.
Life sciences, 135, 1-8 (2015-06-03)
bFGF is a potent mitogen of cells associated with fibrosis. Although ERK5 has been reported to play roles in the development of fibrosis, its roles in regulating bFGF-induced fibrotic responses are not understood, especially in lung fibroblasts. The authors investigated
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.