Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU137841

Sigma-Aldrich

MISSION® esiRNA

targeting human CENPE

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGGCTTGAGTTGGCTCAGAAACTTAATGAAAATTATGAGGAAGTGAAATCTATAACCAAAGAAAGAAAAGTTCTAAAGGAATTACAGAAGTCATTTGAAACAGAGAGAGACCACCTTAGAGGATATATAAGAGAAATTGAAGCTACAGGCCTACAAACCAAAGAAGAACTAAAAATTGCTCATATTCACCTAAAAGAACACCAAGAAACTATTGATGAACTAAGAAGAAGCGTATCTGAGAAGACAGCTCAAATAATAAATACTCAGGACTTAGAAAAATCCCATACCAAATTACAAGAAGAGATCCCAGTGCTTCATGAGGAACAAGAGTTACTGCCTAATGTGAAAGAAGTCAGTGAGACTCAGGAAACAATGAATGAACTGGAGTTATTAACAGAACAGTCCACAACCAAGGACTCAACAACACTGGCAA

Ensembl | Human Hinterlegungsnummer

ENSG00000138778

NCBI-Hinterlegungsnummer

NM_001813

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CENPE(1062) , CENPE(1062)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zijie Liu et al.
Journal of experimental & clinical cancer research : CR, 28, 156-156 (2009-12-22)
CENP-E, one of spindle checkpoint proteins, plays a crucial role in the function of spindle checkpoint. Once CENP-E expression was interrupted, the chromosomes can not separate procedurally, and may result in aneuploidy which is a hallmark of most solid cancers
Lina Shan et al.
International journal of oncology, 55(1), 257-266 (2019-05-23)
Lung cancer is the most common and most lethal type of cancer. A sustained proliferative capacity is one of the hallmarks of cancer, and microtubules serve an important role in maintaining a sustained cell cycle. Therefore, understanding the regulation of
Vitali Sikirzhytski et al.
The Journal of cell biology, 217(8), 2647-2659 (2018-06-17)
For proper segregation during cell division, each chromosome must connect to the poles of the spindle via microtubule bundles termed kinetochore fibers (K-fibers). K-fibers form by two distinct mechanisms: (1) capture of astral microtubules nucleated at the centrosome by the
Zhen-Yu She et al.
Cell death discovery, 6, 25-25 (2020-05-01)
Kinesin-7 CENP-E is an essential kinetochore motor required for chromosome alignment and congression. However, the specific functions of CENP-E in the spermatogenic cells during spermatogenesis remain unknown. In this study, we find that CENP-E proteins are expressed in the spermatogonia
Carmen Taveras et al.
Cell cycle (Georgetown, Tex.), 18(12), 1349-1363 (2019-05-28)
During mitosis, Aurora B kinase is required for forming proper bi-oriented kinetochore-microtubule attachments. Current models suggest that tension exerted between a pair of sister-kinetochores (inter-kinetochore stretch) produces a spatial separation of Aurora B kinase from kinetochore-associated microtubule binding substrates, such

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.