Direkt zum Inhalt
Merck

EHU110021

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC25A5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGCTGGAGCTGAAAGGGAATTCCGAGGCCTCGGTGACTGCCTGGTTAAGATCTACAAATCTGATGGGATTAAGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTATTATCATCTACCGAGCCGCCTACTTCGGTATCTATGACACTGCAAAGGGAATGCTTCCGGATCCCAAGAACACTCACATCGTCATCAGCTGGATGATCGCACAGACTGTCACTGCTGTTGCCGGGTTGACTTCCTATCCATTTGACACTGTTCGCCGCCGCATGATGATGCAGTCAGGGCGCAAAGGAACTGACATCATGTACACAGGCACGCTTGACTGCTGGCGGAAGATTGCTCGTGATGAAGGAGGCAAAGCTTTTTTCAAGGGTGCATGGTCCAATGTTCTCAGAGGCATGGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Linh Ho et al.
Aging, 5(11), 835-849 (2013-12-04)
Efficient coupling of cellular energy production to metabolic demand is crucial to maintain organismal homeostasis. Here, we report that the mitochondrial Sirtuin Sirt4 regulates mitochondrial ATP homeostasis. We find that Sirt4 affects mitochondrial uncoupling via the adenine nucleotide translocator 2
Yun Choi et al.
BMC cancer, 13, 143-143 (2013-03-26)
It is important to simultaneously induce strong cell death and antitumor immunity in cancer patients for successful cancer treatment. Here, we investigated the cytotoxic and phenotypic modulation effects of the combination of ANT2 shRNA and human sodium iodide symporter (hNIS)
Ji-Young Jang et al.
Breast cancer research : BCR, 10(1), R11-R11 (2008-02-13)
Adenine nucleotide translocator (ANT) 2 is highly expressed in proliferative cells, and ANT2 induction in cancer cells is known to be directly associated with glycolytic metabolisms and carcinogenesis. In addition, ANT2 repression results in the growth arrest of human cells
Ji-Young Jang et al.
Molecular cancer, 9, 262-262 (2010-09-30)
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL; apo2 ligand) induces apoptosis in cancer cells but has little effect on normal cells. However, many cancer cell types are resistant to TRAIL-induced apoptosis, limiting the clinical utility of TRAIL as an anti-cancer
Ji-Young Jang et al.
Experimental & molecular medicine, 45, e3-e3 (2013-01-12)
MicroRNAs (miRNAs) participate in diverse biological functions and carcinogenesis by inhibiting specific gene expression. We previously reported that suppression of adenine nucleotide translocase 2 (ANT2) by using the short hairpin RNA (shRNA) approach has an antitumor effect in several cancer

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.