Direkt zum Inhalt
Merck

EHU107481

Sigma-Aldrich

MISSION® esiRNA

targeting human GBP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCATCATCAGATCGTTGCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTATTCGAAACCAGGGGGCTATCGTCTCTTTGTTCAGAAGCTACAAGACCTGAAGAAAAAGTACTATGAGGAACCGAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTATGACTGATGCAATTCTCCAGACAGACCAGACTCTCACAGAAAAAGAAAAGGAGATTGAAGTGGAACGTGTGAAAGCTGAGTCTGCACAGGCTTCAGCAAAAATGTTGCAGGAAATGCAAAGAAAGAATGAGCAGATGATGGAACAGAAGGAGAGGAGTTATCAGGAACACTTGAAACAACTGACTGAGAAGATGGAGAACGACAGGGTCCAGTTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Kun Zhang et al.
Oncotarget, 8(18), 30422-30437 (2017-04-19)
H5N1 avian influenza viruses are a major pandemic concern. In contrast to the highly virulent phenotype of H5N1 in humans and many animal models, guinea pigs do not typically display signs of severe disease in response to H5N1 virus infection.
J Song et al.
European review for medical and pharmacological sciences, 24(10), 5465-5472 (2020-06-05)
Non-small cell lung cancer (NSCLC) is one of the most ordinary cancers worldwide. Recent studies have discovered many oncogenes play vital roles in the tumorigenesis of malignant tumors. The purpose of our study was to uncover the role of GBP1
Ichiko Yamakita et al.
Biochemical and biophysical research communications, 518(2), 266-272 (2019-08-20)
Previously, we identified molecules involved in human invasive lung adenocarcinoma, and guanylate-binding protein 1 (GBP-1) was selected for further analysis. RT-PCR of normal lung and invasive lung adenocarcinoma tissue samples showed that the relative GBP-1 expression levels normalized to GAPDH
Arda Halu et al.
eLife, 7 (2018-10-12)
The role of pro-inflammatory macrophage activation in cardiovascular disease (CVD) is a complex one amenable to network approaches. While an indispensible tool for elucidating the molecular underpinnings of complex diseases including CVD, the interactome is limited in its utility as
Motoi Fukumoto et al.
Cancer science, 105(10), 1351-1359 (2014-08-08)
Standard fractionated radiotherapy for the treatment of cancer consists of daily irradiation of 2-Gy X-rays, 5 days a week for 5-8 weeks. To understand the characteristics of radioresistant cancer cells and to develop more effective radiotherapy, we established a series

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.