Direkt zum Inhalt
Merck

EHU106951

MISSION® esiRNA

targeting human AKR1B1

Anmelden zur Ansicht der Organisations- und Vertragspreise.

Größe auswählen


Über diesen Artikel

NACRES:
NA.51
UNSPSC Code:
41105324
Technischer Dienst
Benötigen Sie Hilfe? Unser Team von erfahrenen Wissenschaftlern ist für Sie da.
Unterstützung erhalten
Technischer Dienst
Benötigen Sie Hilfe? Unser Team von erfahrenen Wissenschaftlern ist für Sie da.
Unterstützung erhalten

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGACCTGAAGCTGGACTACCTGGACCTCTACCTTATTCACTGGCCGACTGGCTTTAAGCCTGGGAAGGAATTTTTCCCATTGGATGAGTCGGGCAATGTGGTTCCCAGTGACACCAACATTCTGGACACGTGGGCGGCCATGGAAGAGCTGGTGGATGAAGGGCTGGTGAAAGCTATTGGCATCTCCAACTTCAACCATCTCCAGGTGGAGATGATCTTAAACAAACCTGGCTTGAAGTATAAGCCTGCAGTTAACCAGATTGAGTGCCACCCATATCTCACTCAGGAGAAGTTAATCCAGTACTGCCAGTCCAAAGGCATCGTGGTGACCGCCTACAGCCCCCTCGGCTCTCCTGACAGGCCCTGGGCCAAGCCCGAGGACCCTTCTCTCCTGGAGGATCCCAGGATCAAGGCGATCGCAGCCAAGCACAATAAAACTACAGCCCAGGTCCTGATCCGGTTCCCCATGCAGAGGAACTTGGTGGTGATCCCCAAGTCTGTGACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AKR1B1(231)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklasse

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xuebiao Wu et al.
The Journal of experimental medicine, 214(4), 1065-1079 (2017-03-09)
Basal-like breast cancer (BLBC) is associated with high-grade, distant metastasis and poor prognosis. Elucidating the determinants of aggressiveness in BLBC may facilitate the development of novel interventions for this challenging disease. In this study, we show that aldo-keto reductase 1
Boel De Paepe et al.
Frontiers in neurology, 9, 846-846 (2018-10-27)
We recently identified osmolyte accumulators as novel biomarkers for chronic skeletal muscle inflammation and weakness, but their precise involvement in inflammatory myopathies remains elusive. In the current study, we demonstrate in vitro that, in myoblasts and myotubes exposed to pro-inflammatory
Pabitra B Pal et al.
Endocrinology, 158(10), 3661-3675 (2017-09-25)
Despite recent studies that show oxidative stress-generated reactive oxygen species (ROS) regulate NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome-mediated innate immune response in various diabetic complications, the mechanism by which ROS activate innate immune response is not well
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Xianwei Li et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 19(5), 401-411 (2015-09-04)
Aldose reductase (AR) is known to play a crucial role in the mediation of diabetic and cardiovascular complications. Recently, several studies have demonstrated that allergen-induced airway remodeling and ovalbumin-induced asthma is mediated by AR. Epalrestat is an aldose reductase inhibitor

Global Trade Item Number

SKUGTIN
EHU106951-50UG04061828377602
EHU106951-20UG04061828603299

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung