Direkt zum Inhalt
Merck

EHU104541

Sigma-Aldrich

MISSION® esiRNA

targeting human AKR1C3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GATTTGGCACCTATGCACCTCCAGAGGTTCCGAGAAGTAAAGCTTTGGAGGTCACAAAATTAGCAATAGAAGCTGGGTTCCGCCATATAGATTCTGCTCATTTATACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAGATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAGCTTTGGTCCACTTTTCATCGACCAGAGTTGGTCCGACCAGCCTTGGAAAACTCACTGAAGAAAGCTCAATTGGACTATGTTGACCTCTATCTTATTCATTCTCCAATGTCTCTAAAGCCAGGTGAGGAACTTTCACCAACAGATGAAAATGGAAAAGTAATATTTGACATAGTGGATCTCTGTACCACCTGGGAGGCCATGGAGAAGTGTAAGGATGCAGGATTGGCCAAGTCCATTGGGGTGTCAAA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yoshitaka Sekine et al.
Oncology letters, 15(3), 3167-3172 (2018-02-13)
Statins have become of interest in research due to their anticancer effects. However, the exact mechanism of their anticancer properties remains unclear. The authors previously reported that statins decrease intracellular cholesterol levels in androgen-independent prostate cancer cells. In de novo
Melanie M Erzinger et al.
PloS one, 11(3), e0150219-e0150219 (2016-03-08)
The chemoprotective properties of sulforaphane (SF), derived from cruciferous vegetables, are widely acknowledged to arise from its potent induction of xenobiotic-metabolizing and antioxidant enzymes. However, much less is known about the impact of SF on the efficacy of cancer therapy
Chengfei Liu et al.
Molecular cancer therapeutics, 16(1), 35-44 (2016-10-30)
Abiraterone suppresses intracrine androgen synthesis via inhibition of CYP17A1. However, clinical evidence suggests that androgen synthesis is not fully inhibited by abiraterone and the sustained androgen production may lead to disease relapse. In the present study, we identified AKR1C3, an
Chengfei Liu et al.
Molecular cancer therapeutics, 18(10), 1875-1886 (2019-07-17)
The mechanisms resulting in resistance to next-generation antiandrogens in castration-resistant prostate cancer are incompletely understood. Numerous studies have determined that constitutively active androgen receptor (AR) signaling or full-length AR bypass mechanisms may contribute to the resistance. Previous studies established that

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.