Direkt zum Inhalt
Merck

EHU089731

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGACCAGGAAGTCCATTTCAGCTCCCAGCTGATACGCCTCCTCCTGCCTATATGCCACCTGATGATCAGATGGGTCAAGATAATTCCCAGCCTATGGATACAAGCAATAATATGATTCCTCAGATTATGCCCAGTATATCCAGCAGGGATGTTCAGCCTGTTGCCTATGAAGAGCCTAAACATTGGTGTTCAATAGTCTACTATGAATTAAACAATCGTGTTGGAGAAGCTTTTCATGCATCTTCTACTAGTGTGTTAGTAGATGGATTCACAGATCCTTCAAATAACAAAAGTAGATTCTGCTTGGGTTTGTTGTCAAATGTTAATCGTAATTCGACAATTGAAAACACTAGGCGACATATTGGAAAAGGTGTTCATCTGTACTATGTTGGTGGAGAGGTGTATGCGGAATGCCTCAGTGACAGCAG

Ensembl | Human Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Mateusz Opyrchal et al.
Oncotarget, 8(53), 91803-91816 (2017-12-07)
Although the majority of breast cancers initially respond to the cytotoxic effects of chemotherapeutic agents, most breast cancer patients experience tumor relapse and ultimately die because of drug resistance. Breast cancer cells undergoing epithelial to mesenchymal transition (EMT) acquire a
Linda T Doan et al.
PloS one, 7(9), e44009-e44009 (2012-09-18)
Insights into Bone morphogenetic protein (Bmp) functions during forebrain development have been limited by a lack of Bmp signaling readouts. Here we used a novel Bmp signaling reporter ("BRE-gal" mice) to study Bmp signaling in the dorsal telencephalon. At early
Moyuan Deng et al.
Cell and tissue research, 361(3), 723-731 (2015-04-07)
Local application of bone morphogenetic protein 2 (BMP2) is known to promote large bone defect healing and BMP2-initiated bone regeneration could be enhanced by an additional mechanical stimulation. The C-terminal 24-a.a. peptide of mechano growth factor (MGF24E), a mechanical-sensitive molecule
Mingyue Nie et al.
Biology of reproduction, 93(4), 98-98 (2015-09-25)
In mammals, follicular atresia can be partially triggered by granulosa cell apoptosis. However, very little is known about the functions of miRNAs in granulosa cell apoptosis. We previously reported that hsa-mir-23a (miR-23a) and hsa-mir-27a (miR-27a) were highly expressed in the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.