Direkt zum Inhalt
Merck

EHU085631

Sigma-Aldrich

MISSION® esiRNA

targeting human GNL3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGCCATCAAATGTGGAACCTATGGAAAAGGAGTTTGGGCTTTGCAAAACTGAGAACAAAGCCAAGTCGGGCAAACAGAATTCAAAGAAGCTGTACTGCCAAGAACTTAAAAAGGTGATTGAAGCCTCCGATGTTGTCCTAGAGGTGTTGGATGCCAGAGATCCTCTTGGTTGCAGATGTCCTCAGGTAGAAGAGGCCATTGTCCAGAGTGGACAGAAAAAGCTGGTACTTATATTAAATAAATCAGATCTGGTACCAAAGGAGAATTTGGAGAGCTGGCTAAATTATTTGAAGAAAGAATTGCCAACAGTGGTGTTCAGAGCCTCAACAAAACCAAAGGATAAAGGGAAGATAACCAAGCGTGTGAAGGCAAAGAAGAATGCTGCTCCATTCAGAAGTGAAGTCTGCTTTGGGAAAGAGGGCCTTTGGAAAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Mei-Hong Li et al.
Journal of pediatric surgery, 49(8), 1286-1291 (2014-08-06)
Neuroblastoma (NB) is the most common extracranial solid tumor of childhood. Preliminary data derived from a human angiogenesis array in NB showed that the bioactive lipid sphingosine-1-phosphate (S1P) induced the secretion of several angiogenesis-related proteins including the important inflammatory factor
Tengwei Cao et al.
PloS one, 9(8), e103793-e103793 (2014-08-08)
Atrial hypertrophy and fibrosis are essential pathological features of atrial fibrillation. Recently, adiponectin has become a protein of interest due to its beneficial effects on cardiovascular diseases. However, the molecular mechanism of atrial structural remodeling and signaling pathways evoked by
Zhihong Yuan et al.
PloS one, 9(5), e94241-e94241 (2014-05-21)
It is increasingly recognized that the tumor microenvironment plays a critical role in the initiation and progression of lung cancer. In particular interaction of cancer cells, macrophages, and inflammatory response in the tumor microenvironment has been shown to facilitate cancer
Junyue Xing et al.
Molecular and cellular biology, 35(23), 4043-4052 (2015-09-24)
The tRNA methytransferase NSun2 promotes cell proliferation, but the molecular mechanism has not been elucidated. Here, we report that NSun2 regulates cyclin-dependent kinase 1 (CDK1) expression in a cell cycle-dependent manner. Knockdown of NSun2 decreased the CDK1 protein level, while

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.