Direkt zum Inhalt
Merck

EHU083751

Sigma-Aldrich

MISSION® esiRNA

targeting human VCAM1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGTTGAAGGATGCGGGAGTATATGAATGTGAATCTAAAAACAAAGTTGGCTCACAATTAAGAAGTTTAACACTTGATGTTCAAGGAAGAGAAAACAACAAAGACTATTTTTCTCCTGAGCTTCTCGTGCTCTATTTTGCATCCTCCTTAATAATACCTGCCATTGGAATGATAATTTACTTTGCAAGAAAAGCCAACATGAAGGGGTCATATAGTCTTGTAGAAGCACAGAAGTCAAAAGTGTAGCTAATGCTTGATATGTTCAACTGGAGACACTATTTATCTGTGCAAATCCTTGATACTGCTCATCATTCCTTGAGAAAAACAATGAGCTGAGAGGCAGACTTCCCTGAATGTATTGAACTTGGAAAGAAATGCCCATCTATGTCCCTTGCTGTGAGCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hai-Jian Sun et al.
Scientific reports, 6, 23596-23596 (2016-03-24)
Vascular smooth muscle cells (VSMCs) are indispensible components in foam cell formation. Salusin-β is a stimulator in the progression of atherosclerosis. Here, we showed that salusin-β increased foam cell formation evidenced by accumulation of lipid droplets and intracellular cholesterol content
Ryota Takahashi et al.
Scientific reports, 10(1), 21194-21194 (2020-12-05)
Pancreatic cancer is one of the malignant diseases with the worst prognosis. Resistance to chemotherapy is a major difficulty in treating the disease. We analyzed plasma samples from a genetically engineered mouse model of pancreatic cancer and found soluble vascular
Huilin Ye et al.
Cell death & disease, 9(5), 453-453 (2018-04-20)
Tumor-associated macrophages (TAMs) are frequently found near pancreatic cancer cells, but it is uncertain whether they are involved in pancreatic cancer progression and the Warburg effect. Here, we show that CCL18 secreted by TAMs facilitates malignant progression and induced a
Orawin Prangsaengtong et al.
Vascular medicine (London, England), 23(3), 201-211 (2018-04-10)
Lymphangiogenesis is the process of new vessel formation from pre-existing lymphatic vessels. The process mainly involves cell adhesion, migration, and tubule formation of lymphatic endothelial cells. Tumor-induced lymphangiogenesis is an important factor contributing to promotion of tumor growth and cancer
Yang Cao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 42(1), 346-356 (2017-05-24)
The contribution of the inflammatory mediator interleukin-17 (IL-17) in nonsmall cell lung cancer (NSCLC) malignancy has been reported in the literature. MicroRNA-181a-5p (miR-181a-5p) acts as a tumor suppressor which can regulate target gene at the posttranscriptional level. Our study aimed

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.