Direkt zum Inhalt
Merck

EHU078761

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPM4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGCCTGGAGTCCTACATCTCACAGCAGAAGACGGGCGTGGGAGGGACTGGAATTGACATCCCTGTCCTGCTCCTCCTGATTGATGGTGATGAGAAGATGTTGACGCGAATAGAGAACGCCACCCAGGCTCAGCTCCCATGTCTCCTCGTGGCTGGCTCAGGGGGAGCTGCGGACTGCCTGGCGGAGACCCTGGAAGACACTCTGGCCCCAGGGAGTGGGGGAGCCAGGCAAGGCGAAGCCCGAGATCGAATCAGGCGTTTCTTTCCCAAAGGGGACCTTGAGGTCCTGCAGGCCCAGGTGGAGAGGATTATGACCCGGAAGGAGCTCCTGACAGTCTATTCTTCTGAGGATGGGTCTGAGGAATTCGAGACCATAGTTTTGAAGGCCCTTGTGAAGGCCTGTGGGAGCTCGGAGGCCTCAGCCTACCTGGATGAGCTGCGTT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Elías Leiva-Salcedo et al.
Channels (Austin, Tex.), 11(6), 624-635 (2017-09-07)
Cerebral ischemia-reperfusion injury triggers a deleterious process ending in neuronal death. This process has two components, a glutamate-dependent and a glutamate-independent mechanism. In the glutamate-independent mechanism, neurons undergo a slow depolarization eventually leading to neuronal death. However, little is known
Xi Hong et al.
American journal of physiology. Cell physiology, 316(4), C463-C480 (2018-12-20)
Prostate cancer (PCa) remains one of the leading causes of cancer-related deaths among males. The aim of the current study was to investigate the ability of microRNA-150 (miR-150) targeting transient receptor potential melastatin 4 (TRPM4) to mediate epithelial-mesenchymal transition (EMT)
Fujue Wang et al.
Cellular signalling, 72, 109643-109643 (2020-04-23)
Transient Receptor Potential Melastatin Subfamily Member 4 (TRPM4) has been demonstrated to be aberrantly expressed in several cancers but seldom reported in acute leukemia. Based on database mining and validated experiments, our present data show that TRPM4 is selectively overexpressed
Chun-Xiao Yu et al.
Toxicology letters, 312, 98-108 (2019-05-06)
To investigate the effect of Arsenic Trioxide (ATO) on endothelial cells injury and explore the role of transient receptor potential melastatin 4 channel (TRPM4) in ATO-induced endothelial injury. qRT-PCR was used to examine the mRNA expression of TRPM4 in human
Christian Holzmann et al.
Oncotarget, 6(39), 41783-41793 (2015-10-27)
Impaired Ca2+ signaling in prostate cancer contributes to several cancer hallmarks, such as enhanced proliferation and migration and a decreased ability to induce apoptosis. Na+ influx via transient receptor potential melastatin 4 channel (TRPM4) can reduce store-operated Ca2+ entry (SOCE)

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.